Information

Is there a detectable amount of bacterial DNA in the blood of infected persons?

Is there a detectable amount of bacterial DNA in the blood of infected persons?


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

With which bacterial infection in humans has it been shown that bacterial DNA can be found in the blood?

If any is found it is likely not to be very much, and even difficult to distinguish from human DNA, but presumably recent advances in sequencing should have made it possible.


Everything depends upon the infection and on the general immune status of the patient.

Generally, the prerequisite for DNA to freely circulate in the blood is the presence of bacteria themselves in the blood (bacteraemia). This means that the infection left its original site (where it is usually kept isolated from the blood flow by the immune system). Depending upon the body reaction to this breakthrough, sepsis and/or SIRS can be the consequences.

Under these conditions (not necessarily as severe as sepsis, but in case of proven bacteriemia), the bacteria cells get attacked by the immuno cells, that leads to their eventual lyzing and releasing their content to the blood.

PCR can be used as a method to prove the existence of bacterial DNA. (Here is a publicly available paper on this topic).


Is there a detectable amount of bacterial DNA in the blood of infected persons? - Biology

Figure 1. Friedrich Miescher (1844–1895) discovered nucleic acids.

Our current understanding of DNA began with the discovery of nucleic acids followed by the development of the double-helix model. In the 1860s, Friedrich Miescher (Figure 1), a physician by profession, isolated phosphate-rich chemicals from white blood cells (leukocytes). He named these chemicals (which would eventually be known as DNA) nuclein because they were isolated from the nuclei of the cells.

To see Miescher conduct an experiment step-by-step, click through this review of how he discovered the key role of DNA and proteins in the nucleus.

A half century later, in 1928, British bacteriologist Frederick Griffith reported the first demonstration of bacterial transformation —a process in which external DNA is taken up by a cell, thereby changing its morphology and physiology. Griffith conducted his experiments with Streptococcus pneumoniae, a bacterium that causes pneumonia. Griffith worked with two strains of this bacterium called rough (R) and smooth (S). (The two cell types were called “rough” and “smooth” after the appearance of their colonies grown on a nutrient agar plate.)

The R strain is non-pathogenic (does not cause disease). The S strain is pathogenic (disease-causing), and has a capsule outside its cell wall. The capsule allows the cell to escape the immune responses of the host mouse.

When Griffith injected the living S strain into mice, they died from pneumonia. In contrast, when Griffith injected the live R strain into mice, they survived. In another experiment, when he injected mice with the heat-killed S strain, they also survived. This experiment showed that the capsule alone was not the cause of death. In a third set of experiments, a mixture of live R strain and heat-killed S strain were injected into mice, and—to his surprise—the mice died. Upon isolating the live bacteria from the dead mouse, only the S strain of bacteria was recovered. When this isolated S strain was injected into fresh mice, the mice died. Griffith concluded that something had passed from the heat-killed S strain into the live R strain and transformed it into the pathogenic S strain. He called this the transforming principle (Figure 2). These experiments are now known as Griffith’s transformation experiments.

Figure 2. Two strains of S. pneumoniae were used in Griffith’s transformation experiments. The R strain is non-pathogenic. The S strain is pathogenic and causes death. When Griffith injected a mouse with the heat-killed S strain and a live R strain, the mouse died. The S strain was recovered from the dead mouse. Thus, Griffith concluded that something had passed from the heat-killed S strain to the R strain, transforming the R strain into S strain in the process. (credit “living mouse”: modification of work by NIH credit “dead mouse”: modification of work by Sarah Marriage)

Scientists Oswald Avery, Colin MacLeod, and Maclyn McCarty (1944) were interested in exploring this transforming principle further. They isolated the S strain from the dead mice and isolated the proteins and nucleic acids (RNA and DNA) as these were possible candidates for the molecule of heredity. They used enzymes that specifically degraded each component and then used each mixture separately to transform the R strain. They found that when DNA was degraded, the resulting mixture was no longer able to transform the bacteria, whereas all of the other combinations were able to transform the bacteria. This led them to conclude that DNA was the transforming principle.

Forensic Scientists and DNA Analysis

Forensic Scientists used DNA analysis evidence for the first time to solve an immigration case. The story started with a teenage boy returning to London from Ghana to be with his mother. Immigration authorities at the airport were suspicious of him, thinking that he was traveling on a forged passport. After much persuasion, he was allowed to go live with his mother, but the immigration authorities did not drop the case against him. All types of evidence, including photographs, were provided to the authorities, but deportation proceedings were started nevertheless. Around the same time, Dr. Alec Jeffreys of Leicester University in the United Kingdom had invented a technique known as DNA fingerprinting . The immigration authorities approached Dr. Jeffreys for help. He took DNA samples from the mother and three of her children, as well as an unrelated mother, and compared the samples with the boy’s DNA. Because the biological father was not in the picture, DNA from the three children was compared with the boy’s DNA. He found a match in the boy’s DNA for both the mother and his three siblings. He concluded that the boy was indeed the mother’s son.

Forensic scientists analyze many items, including documents, handwriting, firearms, and biological samples. They analyze the DNA content of hair, semen, saliva, and blood, and compare it with a database of DNA profiles of known criminals. Analysis includes DNA isolation, sequencing, and sequence analysis. Forensic scientists are expected to appear at court hearings to present their findings. They are usually employed in crime labs of city and state government agencies. Geneticists experimenting with DNA techniques also work for scientific and research organizations, pharmaceutical industries, and college and university labs. Students wishing to pursue a career as a forensic scientist should have at least a bachelor’s degree in chemistry, biology, or physics, and preferably some experience working in a laboratory.

Although the experiments of Avery, McCarty and McLeod had demonstrated that DNA was the informational component transferred during transformation, DNA was still considered to be too simple a molecule to carry biological information. Proteins, with their 20 different amino acids, were regarded as more likely candidates. The decisive experiment, conducted by Martha Chase and Alfred Hershey in 1952, provided confirmatory evidence that DNA was indeed the genetic material and not proteins. Chase and Hershey were studying a bacteriophage —a virus that infects bacteria. Viruses typically have a simple structure: a protein coat, called the capsid, and a nucleic acid core that contains the genetic material (either DNA or RNA). The bacteriophage infects the host bacterial cell by attaching to its surface, and then it injects its nucleic acids inside the cell. The phage DNA makes multiple copies of itself using the host machinery, and eventually the host cell bursts, releasing a large number of bacteriophages. Hershey and Chase selected radioactive elements that would specifically distinguish the protein from the DNA in infected cells. They labeled one batch of phage with radioactive sulfur, 35 S, to label the protein coat. Another batch of phage were labeled with radioactive phosphorus, 32 P. Because phosphorous is found in DNA, but not protein, the DNA and not the protein would be tagged with radioactive phosphorus. Likewise, sulfur is absent from DNA, but present in several amino acids such as methionine and cysteine.

Each batch of phage was allowed to infect the cells separately. After infection, the phage bacterial suspension was put in a blender, which caused the phage coat to detach from the host cell. Cells exposed long enough for infection to occur were then examined to see which of the two radioactive molecules had entered the cell. The phage and bacterial suspension was spun down in a centrifuge. The heavier bacterial cells settled down and formed a pellet, whereas the lighter phage particles stayed in the supernatant. In the tube that contained phage labeled with 35 S, the supernatant contained the radioactively labeled phage, whereas no radioactivity was detected in the pellet. In the tube that contained the phage labeled with 32 P, the radioactivity was detected in the pellet that contained the heavier bacterial cells, and no radioactivity was detected in the supernatant. Hershey and Chase concluded that it was the phage DNA that was injected into the cell and carried information to produce more phage particles, thus providing evidence that DNA was the genetic material and not proteins (Figure 3).

Figure 3. In Hershey and Chase’s experiments, bacteria were infected with phage radiolabeled with either 35S, which labels protein, or 32P, which labels DNA. Only 32P entered the bacterial cells, indicating that DNA is the genetic material.

Around this same time, Austrian biochemist Erwin Chargaff examined the content of DNA in different species and found that the amounts of adenine, thymine, guanine, and cytosine were not found in equal quantities, and that relative concentrations of the four nucleotide bases varied from species to species, but not within tissues of the same individual or between individuals of the same species. He also discovered something unexpected: That the amount of adenine equaled the amount of thymine, and the amount of cytosine equaled the amount of guanine (that is, A = T and G = C). Different species had equal amounts of purines (A+G) and pyrimidines (T + C), but different ratios of A+T to G+C. These observations became known as Chargaff’s rules . Chargaff’s findings proved immensely useful when Watson and Crick were getting ready to propose their DNA double helix model! You can see after reading the past few pages how science builds upon previous discoveries, sometimes in a slow and laborious process.

Practice Question

The experiments by Hershey and Chase helped confirm that DNA was the hereditary material on the basis of the finding that:

  1. radioactive phage were found in the pellet
  2. radioactive cells were found in the supernatant
  3. radioactive sulfur was found inside the cell
  4. radioactive phosphorus was found in the cell

In Summary: The History of DNA

DNA was first isolated from white blood cells by Friedrich Miescher, who called it nuclein because it was isolated from nuclei. Frederick Griffith’s experiments with strains of Streptococcus pneumoniae provided the first hint that DNA may be the transforming principle. Avery, MacLeod, and McCarty proved that DNA is required for the transformation of bacteria. Later experiments by Hershey and Chase using bacteriophage T2 proved that DNA is the genetic material. Chargaff found that the ratio of A = T and C = G, and that the percentage content of A, T, G, and C is different for different species.


Relationship of human herpesvirus 8 peripheral blood virus load and Kaposi's sarcoma clinical stage

Objective: To determine the relationship between human herpesvirus 8 (HHV-8 or Kaposi's sarcoma-associated herpesvirus) peripheral blood virus load and Kaposi's sarcoma (KS) clinical stage.

Design: Blinded, cross-sectional analysis of peripheral blood HHV-8 DNA levels in persons with AIDS-related KS in Harare, Zimbabwe.

Methods: Subjects were stratified by KS clinical stage. The amount of HHV-8 DNA in plasma and peripheral blood mononuclear cells (PBMC) was determined by quantitative real-time PCR amplification of the HHV-8 open reading frame 26.

Results: Thirty-one HIV-1/HHV-8-coinfected persons were studied: 26 subjects had histologically confirmed KS (one stage II, 11 stage III and 14 stage IV) and five subjects had antibodies to HHV-8 but did not have KS. The age, CD4 lymphocyte count and plasma HIV-1 RNA levels were similar in all groups. HHV-8 DNA was detected in the plasma of all HHV-8-infected subjects (range < 2.4 to 5.2 log10 copies/ml), but plasma HHV-8 DNA levels were not associated with KS disease stage. In contrast, the amount of HHV-8 DNA in PBMC (range < 0.7 to 4.5 log10 copies/microg) was strongly associated with KS clinical stage (P = 0.005). Among stage IV KS cases, there was a linear relationship between plasma and PBMC HHV-8 DNA levels (r2 = 0.42 P = 0.01).

Conclusion: The strong association observed between the extent of KS disease and the levels of HHV-8 DNA in PBMC provides further evidence for a relationship between HHV-8 virus load and KS pathogenesis.


Is there a detectable amount of bacterial DNA in the blood of infected persons? - Biology

As molecular techniques for identifying and detecting microorganisms in the clinical microbiology laboratory have become routine, questions about the cost of these techniques and their contribution to patient care need to be addressed. Molecular diagnosis is most appropriate for infectious agents that are difficult to detect, identify, or test for susceptibility in a timely fashion with conventional methods.

The tools of molecular biology have proven readily adaptable for use in the clinical diagnostic laboratory and promise to be extremely useful in diagnosis, therapy, and epidemiologic investigations and infection control (1,2). Although technical issues such as ease of performance, reproducibility, sensitivity, and specificity of molecular tests are important, cost and potential contribution to patient care are also of concern (3). Molecular methods may be an improvement over conventional microbiologic testing in many ways. Currently, their most practical and useful application is in detecting and identifying infectious agents for which routine growth-based culture and microscopy methods may not be adequate (47).

Nucleic acid-based tests used in diagnosing infectious diseases use standard methods for isolating nucleic acids from organisms and clinical material and restriction endonuclease enzymes, gel electrophoresis, and nucleic acid hybridization techniques to analyze DNA or RNA (6). Because the target DNA or RNA may be present in very small amounts in clinical specimens, various signal amplification and target amplification techniques have been used to detect infectious agents in clinical diagnostic laboratories (5,6). Although mainly a research tool, nucleic acid sequence analysis coupled with target amplification is clinically useful and helps detect and identify previously uncultivatable organisms and characterize antimicrobial resistance gene mutations, thus aiding both diagnosis and treatment of infectious diseases (5,8,9). Automation and high-density oligonucleotide probe arrays (DNA chips) also hold great promise for characterizing microbial pathogens (6).

Although most clinicians and microbiologists enthusiastically welcome the new molecular tests for diagnosing infectious disease, the high cost of these tests is of concern (3). Despite the probability that improved patient outcome and reduced cost of antimicrobial agents and length of hospital stay will outweigh the increased laboratory costs incurred through the use of molecular testing, such savings are difficult to document (3,10,11). Much of the justification for expenditures on molecular testing is speculative (11) however, the cost of equipment, reagents, and trained personnel is real and substantial, and reimbursement issues are problematic (3,11). Given these concerns, a facility's need for molecular diagnostic testing for infectious diseases should be examined critically by the affected clinical and laboratory services. In many instances, careful overseeing of test ordering and prudent use of a reference laboratory may be the most viable options.

Practical Applications of Molecular Methods in the Clinical Microbiology Laboratory

Commercial kits for the molecular detection and identification of infectious pathogens have provided a degree of standardization and ease of use that has facilitated the introduction of molecular diagnostics into the clinical microbiology laboratory (Table 1). The use of nucleic acid probes for identifying cultured organisms and for direct detection of organisms in clinical material was the first exposure that most laboratories had to commercially available molecular tests. Although these probe tests are still widely used, amplification-based methods are increasingly employed for diagnosis, identification and quantitation of pathogens, and characterization of antimicrobial-drug resistance genes. Commercial amplification kits are available for some pathogens (Table 1), but some clinically important pathogens require investigator-designed or "home-brew" methods (Table 2). In addition, molecular strain typing, or genotyping, has proven useful in guiding therapeutic decisions for certain viral pathogens and for epidemiologic investigation and infection control (2,12).

Detection and Identification of Pathogens Without Target Amplification

Commercial kits containing non-isotopically labeled nucleic acid probes are available for direct detection of pathogens in clinical material and identification of organisms after isolation in culture (Table 1). Use of solution-phase hybridization has allowed tests to be performed singly or in batches in a familiar microwell format.

Although direct detection of organisms in clinical specimens by nucleic acid probes is rapid and simple, it suffers from lack of sensitivity. Most direct probe detection assays require at least 10 4 copies of nucleic acid per microliter for reliable detection, a requirement rarely met in clinical samples without some form of amplification. Amplification of the detection signal after probe hybridization improves sensitivity to as low as 500 gene copies per microliter and provides quantitative capabilities. This approach has been used extensively for quantitative assays of viral load (HIV, hepatitis B virus [HBV] and hepatitis C virus [HCV]) (Table 1) but does not match the analytical sensitivity of target amplification-based methods, such as polymerase chain reaction (PCR), for detecting organisms.

The commercial probe systems that use solution-phase hybridization and chemiluminescence for direct detection of infectious agents in clinical material include the PACE2 products of Gen-Probe and the hybrid capture assay systems of Digene and Murex (Table 1). These systems are user friendly, have a long shelf life, and are adaptable to small or large numbers of specimens. The PACE2 products are designed for direct detection of both Neisseria gonorrhoeae and Chlamydia trachomatis in a single specimen (one specimen, two separate probes). The hybrid capture systems detect human papilloma virus (HPV) in cervical scrapings, herpes simplex virus (HSV) in vesicle material, and cytomegalovirus (CMV) in blood and other fluids. All these tests have demonstrated sensitivity exceeding that of culture or immunologic methods for detecting the respective pathogens but are less sensitive than PCR or other target amplification-based methods.

The signal amplification-based probe methods for detection and quantitation of viruses (HBV, HCV, HIV) are presented in an enzyme immunoassay-like format and include branched chain DNA probes (Chiron) and QB replicase (Gene-Trak) methods (Table 1). These methods are not as sensitive as target amplification-based methods for detection of viruses however, the quantitative results have proven useful for determining viral load and prognosis and for monitoring response to therapy (13).

Probe hybridization is useful for identifying slow-growing organisms after isolation in culture using either liquid or solid media. Identification of mycobacteria and other slow-growing organisms such as the dimorphic fungi (Histoplasma capsulatum, Coccidioides immitis, and Blastomyces dermatitidis) has certainly been facilitated by commercially available probes. All commercial probes for identifying organisms are produced by Gen-Probe and use acridinium ester-labeled probes directed at species-specific rRNA sequences (Table 1). Gen-Probe products are available for the culture identification of Mycobacterium tuberculosis, M. avium-intracellulare complex, M. gordonae, M. kansasii, Cryptococcus neoformans, the dimorphic fungi (listed above), N. gonorrhoeae, Staphylococcus aureus, Streptococcus pneumoniae, Escherichia coli, Haemophilus influenzae, Enterococcus spp., S. agalactiae, and Listeria monocytogenes. The sensitivity and specificity of these probes are excellent, and they provide species identification within one working day. Because most of the bacteria listed, plus C. neoformans, can be easily and efficiently identified by conventional methods within 1 to 2 days, many of these probes have not been widely used. The mycobacterial probes, on the other hand, are accepted as mainstays for the identification of M. tuberculosis and related species (7).

Nucleic Acid Amplification

Nucleic acid amplification provides the ability to selectively amplify specific targets present in low concentrations to detectable levels thus, amplification-based methods offer superior performance, in terms of sensitivity, over the direct (non-amplified) probe-based tests. PCR (Roche Molecular Systems, Branchburg, NJ) was the first such technique to be developed and because of its flexibility and ease of performance remains the most widely used molecular diagnostic technique in both research and clinical laboratories. Several different amplification-based strategies have been developed and are available commercially (Table 1). Commercial amplification-based molecular diagnostic systems for infectious diseases have focused largely on systems for detecting N. gonorrhoeae, C. trachomatis, M. tuberculosis, and specific viral infections (HBV, HCV, HIV, CMV, and enterovirus) (Table 1). Given the adaptability of PCR, numerous additional infectious pathogens have been detected by investigator-developed or home-brew PCR assays (5) (Table 2). In many instances, such tests provide important and clinically relevant information that would otherwise be unavailable since commercial interests have been slow to expand the line of products available to clinical laboratories. In addition to qualitative detection of viruses, quantitation of viral load in clinical specimens is now recognized to be of great importance for the diagnosis, prognosis, and therapeutic monitoring for HCV, HIV, HBV, and CMV (13). Both PCR and nucleic acid strand-based amplification systems are available for quantitation of one or more viruses (Table 1).

The adaptation of amplification-based test methods to commercially available kits has served to optimize user acceptability, prevent contamination, standardize reagents and testing conditions, and make automation a possibility. It is not clear to what extent the levels of detection achievable by the different amplification strategies differ. None of the newer methods provides a level of sensitivity greater than that of PCR. In choosing a molecular diagnostic system, one should consider the range of tests available, suitability of the method to workflow, and cost (6). Choosing one amplification-based method that provides testing capabilities for several pathogens is certainly practical.

Amplification-based methods are also valuable for identifying cultured and non-cultivatable organisms (5). Amplification reactions may be designed to rapidly identify an acid-fast organism as M. tuberculosis or may amplify a genus-specific or "universal" target, which then is characterized by using restriction endonuclease digestion, hybridization with multiple probes, or sequence determination to provide species or even subspecies delineation (4,5,14). Although identification was initially applied to slow-growing mycobacteria, it has applications for other pathogens that are difficult or impossible to identify with conventional methods.

Detecting Antimicrobial-Drug Resistance

Molecular methods can rapidly detect antimicrobial-drug resistance in clinical settings and have substantially contributed to our understanding of the spread and genetics of resistance (9). Conventional broth- and agar-based antimicrobial susceptibility testing methods provide a phenotypic profile of the response of a given microbe to an array of agents. Although useful for selecting potentially useful therapeutic agents, conventional methods are slow and fraught with problems. The most common failing is in the detection of methicillin resistance in staphylococci, which may be expressed in a very heterogeneous fashion, making phenotypic characterization of resistance difficult (9,15). Currently, molecular detection of the resistance gene, mec A, is the standard against which phenotypic methods for detection of methicillin resistance are judged (9,15,16).

Molecular methods may be used to detect specific antimicrobial-drug resistance genes (resistance genotyping) in many organisms (Table 3) (8,9). Detection of specific point mutations associated with resistance to antiviral agents is also increasingly important (17,18). Screening for mutations in an amplified product may be facilitated by the use of high-density probe arrays (Gene chips) (6).

Despite its many potential advantages, genotyping will not likely replace phenotypic methods for detecting antimicrobial-drug resistance in the clinical laboratory in the near future. Molecular methods for resistance detection may be applied directly to the clinical specimen, providing simultaneous detection and identification of the pathogen plus resistance characterization (9). Likewise, they are useful in detecting resistance in viruses, slow-growing or nonviable organisms, or organisms with resistance mechanisms that are not reliably detected by phenotypic methods (9,19). However, because of their high specificity, molecular methods will not detect newly emerging resistance mechanisms and are unlikely to be useful in detecting resistance genes in species where the gene has not been observed previously (19). Furthermore, the presence of a resistance gene does not mean that the gene will be expressed, and the absence of a known resistance gene does not exclude the possibility of resistance from another mechanism. Phenotypic antimicrobial susceptibility testing methods allow laboratories to test many organisms and detect newly emerging as well as established resistance patterns.

Molecular Epidemiology

Figure. Pulsed-field gel electrophoresis (PFGE) profiles of Staphylococcus aureus isolates digested with Sma 1. A variety of PFGE profiles are demonstrated in these 23 isolates.

Laboratory characterization of microbial pathogens as biologically or genetically related is frequently useful in investigations (12,20,21). Several different epidemiologic typing methods have been applied in studies of microbial pathogens (Table 4). The phenotypic methods have occasionally been useful in describing the epidemiology of infectious diseases however, they are too variable, slow, and labor-intensive to be of much use in most epidemiologic investigations. Newer DNA-based typing methods have eliminated most of these limitations and are now the preferred techniques for epidemiologic typing. The most widely used molecular typing methods include plasmid profiling, restriction endonuclease analysis of plasmid and genomic DNA, Southern hybridization analysis using specific DNA probes, and chromosomal DNA profiling using either pulsed-field gel electrophoresis (PFGE) or PCR-based methods (12,20). All these methods use electric fields to separate DNA fragments, whole chromosomes, or plasmids into unique patterns or fingerprints that are visualized by staining with ethidium bromide or by nucleic acid probe hybridization (Figure). Molecular typing is performed to determine whether different isolates give the same or different results for one or more tests. Epidemiologically related isolates share the same DNA profile or fingerprint, whereas sporadic or epidemiologically unrelated isolates have distinctly different patterns (Figure). If isolates from different patients share the same fingerprint, they probably originated from the same clone and were transmitted from patient to patient by a common source or mechanism.

Molecular typing methods have allowed investigators to study the relationship between colonizing and infecting isolates in individual patients, distinguish contaminating from infecting strains, document nosocomial transmission in hospitalized patients, evaluate reinfection versus relapse in patients being treated for an infection, and follow the spread of antimicrobial-drug resistant strains within and between hospitals over time (12). Most available DNA-based typing methods may be used in studying nosocomial infections when applied in the context of a careful epidemiologic investigation (12,21). In contrast, even the most powerful and sophisticated typing method, if used indiscriminately in the absence of sound epidemiologic data, may provide conflicting and confusing information.

Financial Considerations

Molecular testing for infectious diseases includes testing for the host's predisposition to disease, screening for infected or colonized persons, diagnosis of clinically important infections, and monitoring the course of infection or the spread of a specific pathogen in a given population. It is often assumed that in addition to improved patient care, major financial benefits may accrue from molecular testing because the tests reduce the use of less sensitive and specific tests, unnecessary diagnostic procedures and therapies, and nosocomial infections (11). However, the inherent costs of molecular testing methods, coupled with variable and inadequate reimbursement by third-party payers and managed-care organizations, have limited the introduction of these tests into the clinical diagnostic laboratory.

Not all molecular diagnostic tests are extremely expensive. Direct costs vary widely, depending on the test's complexity and sophistication. Inexpensive molecular tests are generally kit based and use methods that require little instrumentation or technologist experience. DNA probe methods that detect C. trachomatis or N. gonorrhoeae are examples of low-cost molecular tests. The more complex molecular tests, such as resistance genotyping, often have high labor costs because they require experienced, well-trained technologists. Although the more sophisticated tests may require expensive equipment (e.g., DNA sequencer) and reagents, advances in automation and the production of less-expensive reagents promise to decrease these costs as well as technician time. Major obstacles to establishing a molecular diagnostics laboratory that are often not considered until late in the process are required licenses, existing and pending patents, test selection, and billing and reimbursement (22).

Reimbursement issues are a major source of confusion, frustration, and inconsistency. Reimbursement by third-party payers is confounded by lack of Food and Drug Administration (FDA) approval and Current Procedural Terminology (CPT) codes for many molecular tests. In general, molecular tests for infectious diseases have been more readily accepted for reimbursement however, reimbursement is often on a case-by-case basis and may be slow and cumbersome. FDA approval of a test improves the likelihood that it will be reimbursed but does not ensure that the amount reimbursed will equal the cost of performing the test.

Perhaps more than other laboratory tests, molecular tests may be negatively affected by fee-for-service managed-care contracts and across-the-board discounting of laboratory test fees. Such measures often result in reimbursement that is lower than the cost of providing the test. Although molecular tests may be considered a means of promoting patient wellness, the financial benefits of patient wellness are not easily realized in the short term (11). Health maintenance organizations (HMOs) and managed-care organizations often appear to be operating on shorter time frames, and their administrators may not be interested in the long-term impact of diagnostic testing strategies.

Molecular screening programs for infectious diseases are developed to detect symptomatic and asymptomatic disease in individuals and groups. Persons at high risk, such as immunocompromised patients or those attending family planning or obstetrical clinics, are screened for CMV and Chlamydia, respectively. Likewise, all blood donors are screened for bloodborne pathogens. The financial outcome of such testing is unknown. The cost must be balanced against the benefits of earlier diagnosis and treatment and societal issues such as disease epidemiology and population management.

One of the most highly touted benefits of molecular testing for infectious diseases is the promise of earlier detection of certain pathogens. The rapid detection of M. tuberculosis directly in clinical specimens by PCR or other amplification-based methods is quite likely to be cost-effective in the management of tuberculosis (7). Other examples of infectious disease that are amenable to molecular diagnosis and for which management can be improved by this technology include HSV encephalitis, Helicobacter pylori infection, and neuroborreliosis caused by Borrelia burgdorferi. For HSV encephalitis, detection of HSV in cerebrospinal fluid (CSF) can direct specific therapy and eliminate other tests including brain biopsy. Likewise, detection of H. pylori in gastric fluid can direct therapy and obviate the need for endoscopy and biopsy. PCR detection of B. burgdorferi in CSF is helpful in differentiating neuroborreliosis from other chronic neurologic conditions and chronic fatigue syndrome.

As discussed earlier, molecular tests may be used to predict disease response to specific antimicrobial therapy. Detection of specific resistance genes (mec A, van A) or point mutations resulting in resistance has proven efficacious in managing disease. Molecular-based viral load testing has become standard practice for patients with chronic hepatitis and AIDS. Viral load testing and genotyping of HCV are useful in determining the use of expensive therapy such as interferon and can be used to justify decisions on extent and duration of therapy. With AIDS, viral load determinations plus resistance genotyping have been used to select among the various protease inhibitor drugs available for treatment, improving patient response and decreasing incidence of opportunistic infections.

Pharmacogenomics is the use of molecular-based tests to predict the response to specific therapies and to monitor the response of the disease to the agents administered. The best examples of pharmacogenomics in infectious diseases are the use of viral load and resistance genotyping to select and monitor antiviral therapy of AIDS and chronic hepatitis (17,18). This application improves disease outcome shortens length of hospital stay reduces adverse events and toxicity and facilitates cost-effective therapy by avoiding unnecessary expensive drugs, optimizing doses and timing, and eliminating ineffective drugs.

Molecular strain typing of microorganisms is now well recognized as an essential component of a comprehensive infection control program that also involves the infection control department, the infectious disease division, and pharmacy (10,21). Molecular techniques for establishing presence or absence of clonality are effective in tracking the spread of nosocomial infections and streamlining the activities of the infection control program (21,23). A comprehensive infection control program uses active surveillance by both infection control practitioners and the clinical microbiology laboratory to identify clusters of infections with a common microbial phenotype (same species and antimicrobial susceptibility profile). The isolates are then characterized in the laboratory by using one of a number of molecular typing methods (Table 4) to confirm or refute clonality. Based on available epidemiologic and molecular data, the hospital epidemiologist then develops an intervention strategy. Molecular typing can shorten or prevent an epidemic (23) and reduce the number and cost of nosocomial infections (Table 5) (10). Hacek et al. (10) analyzed the medical and economic benefits of an infection control program that included routine determination of microbial clonality and found that nosocomial infections were significantly decreased and more than $4 million was saved over a 2-year period (Table 5).

The true financial impact of molecular testing will only be realized when testing procedures are integrated into total disease assessment. More expensive testing procedures may be justified if they reduce the use of less-sensitive and less-specific tests and eliminate unnecessary diagnostic procedures and ineffective therapies.

Dr. Pfaller is professor and director of the Molecular Epidemiology and Fungus Testing Laboratory at the University of Iowa College of Medicine and College of Public Health. His research focuses on the epidemiology of nosocomial infections and antimicrobial-drug resistance.


Molecular Basis of Disease Diagnosis and Treatment (With Diagram)

A disease, in molecular sense, can be defined as any abnormality in the living system. The abnormality can be caused due to infection by virus, bacteria, fungi, parasites, proteins or small molecules in/from humans, animals, plants, water and soil. The abnormality can also arise due to changes in the molecular structure within the cells. As an example, a change in the DNA sequence known as mutation can cause various disorders/diseases.

The prevention and treatment of these diseases is possible only if the causative agent of the disease can be diagnosed at the appropriate time. Hitherto many costly and laborious clinical procedures were used in the diagnosis and treatment of these diseases. With the advancement of Molecular Biotechnology, various molecular diagnostic methods are now applied in the diagnosis and also treatment of these diseases.

Molecular Diagnosis:

A diagnostic test can be effective only if it is:

(a) Specific for the target molecule

(b) Sensitive to detect even minute levels of the target and

There are two classes of molecular diagnostic techniques:

(1) DNA detection methods—which uses nucleic acid hybridization or the polymerase chain reaction to detect a specific nucleic acid sequence.

(2) Immunological methods—are based upon the specificity of an antibody for a particular antigen.

1. DNA Detection Methods:

Various methods have been devised for the detection of various diseas­es, based on the sequence of DNA, built in a specific manner.

Some methods discussed here are:

(a) Detection of a pathogenic organism by nucleic acid hybridization

(b) Diagnosis of genetic disease using restriction endonuclease

(c) Diagnosis of genetic disease by P.C.R./oligonucleotide ligation assay (PCR/OLA) and

(d) detection of mutants at different sites within one gene.

(a) Detection of a pathogenic organism by nucleic acid hybridization:

The disease causing (pathogen­ic) organism can be detected very specifically in biological samples by nucleic acid hybridization i.e. if the nucleic acid sequence of a disease causing organism is present in the blood, urine, faeces, etc., then it can be hybridized with a nucleic acid probe complementary to the sequence of this target nucleic acid. If the patho­genic organism is present in the biological sample, hybridization occurs and if not, there is no hybridization.

The parasite Plasmodium falciparum causes malaria in man. A specific gene (thereby its product) is the causative agent in this parasite. A complementary DNA probe to this gene is synthesized chemically with radiolabelled 32 P. This probe is bonded to a membrane support. Then the biological sample to be analysed is added, under appropriate conditions of temperature and ionic strength to promote base pairing between the probe and the target DNA in the sample.

It is then washed to remove the excess of the sample and then the hybridized double stranded DNA is extracted and the hybrid sequences are detected by autoradiography. The specific DNA probe chosen will hybridize only with P. falciparum but not with P. vivax, P. cyanomolgi or human DNA. This probe can detect as little as 10 picogram of purified P. falciparum DNA or 1 Nano gram of P. falciparum DNA in blood samples. If hybridization has occurred then the pathogenic organism is present and if no hybridization occurs (i.e. no radiations) then the pathogenic organism is absent.

The above procedure is adopted for detection of all pathogenic organisms in any biological sample. Here the disadvantage of using the radioactive phosphorus is that it is hazardous, hence now-a-days nonradioactive hybridization procedures are used. In this method all the DNA from the sample is extracted and is bonded to a support, then the biotin-labelled DNA probe complementary to the pathogen DNA is hybrid­ized to the target DNA.

Then, either avidin or streptavidin is added, which will bind to the biotin on the hybridized probe-target DNA. Then a biotin labelled enzyme like alkaline phosphatase is added which binds to the avidin bonded on the probe. Then the substrate specific for this enzyme is added, which will convert the colourless substrate into a coloured product. Appearance of the colour indicates the presence of the pathogenic DNA and non-development of the colour is an indication of the absence of the organism.

(b) Diagnosis of genetic disease using restriction endonuclease:

Sickle-cell anemia is a genetic disease due to the change in a single nucleotide in the codon for the sixth amino acid of the beta-chain of the hemoglobin molecule. The gene for beta-globin in normal persons is designated as A/A, in heterozygous individuals as A/a, and in homozygous individuals as S/s. Individuals containing the sickle gene are screened before the expression of the symptoms and for screening the carrier, who are at risk of transmitting this gene to their offspring.

The principle for the detection is that, within the beta-globin gene of a normal individual, there are three sites for the restriction endonuclease Cvn-1, but in sickle-cell gene one of these sites is lost due to replacement of the single nucleotide.

In the normal gene, the DNA sequence is CCTGAGG whereas in the sickle-cell anemia gene, the sequence is CCTGTGG. Further the recognition sequence and site of cleavage by Cvn-1 is CCTNAGG. Thus, the difference in sequence of normal and sickle-cell gene in the recognition site of Cvn—1 forms the basis of this DNA diagnosis.

Two primers with sequences that can pair within the Cvn-1 sites in the beta-globin gene are added and this part of DNA is amplified using P.C.R. and then digested with Cvn-1. Finally the cleavage products are separated by gel electrophoresis and stained by ethidium bromide.

The results indicate that in the normal gene, four DNA fragments are obtained with 88, 181, 201 and 256 base pairs. But in heterozygous individual five DNA fragments are obtained containing 88, 181, 201, 256 and 382 base pairs and in homozygous individuals only three fragments are obtained with 88, 256 and 382 nucleotide base pairs, indicating the loss of one of the recognition site in the sickle cell gene.

(c) Diagnosis of genetic disease by PCR/OLA procedure:

This procedure is applied for those disorders, due to genetic mutations, which does not affect the restriction endonuclease sites. Let us take an example of a gene, which has undergone mutation at position 98. At this specific site the base pair in the normal gene be C=G and in the mutant gene let it be A=T.

Two oligonucleotides of about 20 nucleotide length each are synthesized with sequence complementary to one of the strands of this gene on either side of position 98. One of these oligonucleotides has biotin at its 5′ end and ‘C’ as the terminal nucleotide at the 3′ end. The other oligonucleotide probe has ‘A’ base nucleotide at the 5′ end and digoxigenin (compound ‘D’) at its 3′ end.

The target DNA is amplified by PCR and then is hybridized with the synthesized probes. The two probes base pair such that the 5′ end of the 2 nd probe lies next to the 3′ end of the 1 st probe. Then DNA ligase is added, which will ligate only the normal DNA fragment but not the mutated fragment hybridized with the probes.

This is because of the mismatch between the 2 nd probe and the mutated gene, which cannot base pair. Further, in order to determine whether ligation has occurred or not, the hybrid probes are taken into a well containing avidin which binds to biotin. Then it is washed, which removes the un-ligated probe.

Then anti-digoxigenin (‘D’ compound) antibody- alkaline phophatase conjugate is added and washed in both the wells (the normal and mutated hybridized probes). It is expected that the antibody enzyme will bind only to the ligated probe well. When substrate is added, the coloured product is produced only in the well where ligation has occurred, whereas no colour is formed where no ligation has taken place.

(d) Detection of mutations at different sites within one gene:

Beta-thalassemia is a genetic disease that is caused due to mutation in beta-globulin at eight or more sites, thus results in low rate of its synthesis. Hence instead of detecting each mutation separately all the eight sites are scanned at the same time.

DNA probes are synthesized to all these eight sites of beta-globin gene where mutations are expected. Each probe is 20 nucleotide in length with a poly T’ tail at the 3′ end. This is used to attach the probe to a membrane. Segments of the sample DNA (beta-gene) that includes each of the possible mutant sites are amplified by PCR, using primers labeled with biotin at the 5′ end.

The amplified target DNA is then hybrid­ized to the membrane bound probes under conditions that allow only perfect matches to hybridize. Then streptavidin with attached alkaline phosphatase is added, the membrane washed and a colourless substrate is added.

A coloured spot on the membrane appears wherever there is a perfect nucleotide match between the amplified target DNA segment and one of the specific oligoneucleotide probes. Where there is no hybridiza­tion (mutant DNA segments) no colour appears. In the illustration given below, gene 1 and 2 are mutated but gene 3 is normal. (Represented as probe 1, 2 and 3 respectively in the figure).

2. Immunological Methods:

Antibody molecules consist of four chains, two identical light chains and two identical heavy chains. The fv (fragment variable) region of each antibody molecule binds tightly to a specific site (epitope) on an antigen. This specificity is used to identify the presence of a particular epitope of a disease causing molecule or organism in a biological sample. There are two methods by which the antigen-antibody reaction or binding is detected.

(a) Radio-immuno assay (RIA):

The concentration of progesterone in blood (for example) is to be determined by RIA. First of all antibodies to progesterone are raised and taken in a test tube containing glass beads. The antibodies get readily attached to the glass beads. Then progesterone containing sample is added to this test tube which binds the antibodies forming antigen-antibody complex, whose concen­tration depends upon the amount of progesterone in the blood sample.

Another test tube is taken and the antibodies are labelled with radioactive compounds like 123 I or 3 H or 14 C. This radio labelled antibody is then added to the first test tube containing progesterone attached to un-labelled antibodies. Radio labelled antibodies will now attach to the progesterone and form labelled antigen-antibody complex which is measured using a scintillation counter.

(b) Enzyme linked immunosorbent assay (ELISA):

The sample which is to be tested for the presence of a specific molecule or organism is bound to a solid support such as a plastic plate. Then a marker- specific antibody (primary antibody) is added to the bound material and then the support is washed to remove unbound primary antibody.

Then a second antibody (secondary antibody) is added, which binds specifically to the primary antibody and not to the target molecule. The secondary antibody contains bound enzyme like alkaline phosphatase which catalyses the conversion of a colorless substrate into a colored product. The system is washed again to remove any unbound secondary antibody-enzyme con­jugate.

Then a colorless substrate is added which is converted to a colored product only if the specific antigen is present, if not there is no colour. If there is no antigen (or the causative agent) then the primary antibody will not bind to the target site in the sample, hence the first washing step removes it. Conse­quently, the secondary antibody—enzymes conjugate will have nothing to bind to and is removed during the second washing step, and the final mixture remains colorless.

Conversely, if the antigen (or the causative agent) or the target site is present in the sample, then the primary antibody binds to it, the secondary antibody binds to the primary antibody and the attached enzyme will catalyze the reaction to from a colored product which can be detected colorimetrically.

Molecular Treatment or Gene Therapy:

In order to treat a genetic disease, the normal gene for that disease has to be sequenced and cloned. This cloned normal gene can be used to correct the defect in individuals who have a mutant form of that gene. Here, the objective is to add a normal functioning gene to defective cells, thereby providing the required protein and correcting the genetic disease. In addition, it will be necessary to prevent the over expression of a deregulated normal gene, in some diseases.

There are three methods for the therapy of genetic diseases:

(2) In vivo gene therapy and

(a) Ex vivo Gene Therapy:

Somatic cells from an affected individual are collected. The isolated cells are grown in culture. These cells are then transfected by retroviral cloning vectors containing the remedial gene construct. The cells are further grown and those cells which contain the gene of interest are selected and finally transplanted or transfused back into the patient. These transplanted transfected cells will synthesize the gene product i.e. the protein. Examples for this type of treatment include gauche disease, sickle cell anaemia, thalassemia etc.

(b) In vivo Gene Therapy:

In this type of treatment there is the direct delivery of the remedial gene into the cells of a particular tissue of the patient, using retroviral vectors. Even plasmid DNA constructs
are used. This type of treatment is used in case of muscular dystrophy, neuronal degeneration and brain cancer patients.

(c) Antisense Therapy:

Antisense therapy is designed to prevent or lower the expression of a specific gene. In some type of genetic diseases and cancers, the genes are deregulated or over expressed resulting in the production of excess of the gene product or its continuous presence in the cell will disrupt the normal functioning of the cell.

In such type of diseases the addition of normal gene will not solve the problem instead blocking the synthesis of the gene product (protein) will be helpful. Thus in anti-sense therapy a nucleic acid sequence is introduced into the target cell which is complementary to complete or a part of that specific mRNA.

Hence the mRNA produced by the normal transcription of the gene will hybridize with the antisense oligonucleotide by base pairing, thereby preventing the translation of this mRNA, resulting in reduced amount of target protein. The antisense therapy is used in treatment of various cancers, AIDS, atherosclerosis, leukemia and sickle cell anaemia.


Results

Patient characteristics

The neonates in the non-infected group had a mean birth weight of 1774 g, gestational age of 32 weeks, and a mean of 20 catheter days. The infected group (with CLABSI) had a mean birth weight of 1454 g, gestational age of 30 weeks, and a mean of 24 catheter days. All but one neonate received antibiotics treatment, with a mean duration of 8 days for non-CLABSI and 11 days for CLABSI groups. Ampicillin and Gentamicin were administered either alone or in combination with other antibiotics in 97 and 93% of the total subjects, respectively (see Tables 1 and S1).

Blood culture isolates

The most common organism isolated by blood culture within 3 days of catheter removal was coagulase-negative staphylococci (CONS) (9/30, 30%), followed by Staphylococcus aureus (4/30, 13.3%). S. epidermidis was the major CONS (5/9, 55.5%) isolated from blood culture (S1 Table for details).

16S V4 rRNA sequencing output

Table 2 provides a summary of the samples processed and analyzed for the study. A summary of sequencing output, including number of reads, quality metrics, and number of OTUs, is presented in Table 3. The raw data generated from our samples (n = 90) had an average of 32,539 reads/sample with ≥Q30 quality score of 64% (see Table 3). However, a total of 7,516 reads (read range: 1–354) belonging to 187 different OTUs (OTU abundance range: 1–2,291) assigned as ‘kingdom_bacteria’ were characterized as ‘unclassified_bacteria’ at the phylum level using the custom pipeline described above.

Unexpectedly, all OTUs assigned as ‘kingdom_bacteria phylum_unclassified_bacteria’ were found to be non-bacterial reads, and almost all of them aligned to human DNA using the NCBI nr/nt and the human genomic plus transcript databases. We thus removed the OTUs failing to classify as bacteria at the kingdom level and unclassified OTUs at the phylum level from downstream analysis. After removing unclassified OTUs at both the kingdom and phylum levels, only 44 (out of 90) samples yielded a useable amount of quality-filtered sequencing data (>100 reads/sample), totaling 406,007 reads belonging to 440 different OTUs.

Application of decontam R-package

A total of 28 OTUs were identified as contaminants by the frequency based decontam classification at a default threshold (0.1) (see S2 Table and S1 Fig for details). Application of the decontam statistical method to our samples (n = 44, each with >100 reads/sample) resulted in an average of 9,122 reads/sample (range: 96–45,180) assigned to 412 different OTUs (Table 3). Downstream analysis, including bacterial diversity and composition was assessed in the contaminants removed dataset.

Bacterial load

Samples from infected catheters (n = 14) contained a significantly higher bacterial load (low cycle of threshold (CT)) than the uninfected catheters (n = 12) as measured using 16S rRNA gene qPCR (Mann-Whitney test p<0.05) (Fig 1). All negative controls (leftmost three sample sets in Fig 1) showed high CT values, indicating low content of 16S rRNA gene. In contrast, stool samples used as positive controls had a high concentration of bacterial DNA (low CT), as expected (rightmost sample set in Fig 1). The bacterial load was also significantly higher in both infected and uninfected catheters than the water and buffer controls (Kruskal Wallis with Dunn’s post-hoc test p<0.05). No significant difference was found in the bacterial load between the infected and uninfected skin swabs (Mann-Whitney test p>0.05). There was no significant difference between skin swab samples and the negative controls either (Kruskal Wallis with Dunn’s post-hoc test p>0.05). We did not perform statistical comparison of the bacterial load between infected and uninfected blood samples because of the small sample size. The 16S qPCR result was similar to that of the Qubit result (measured using PCR amplified 16S V4 rRNA gene) (see S2 Fig).

qPCR analysis of the bacterial 16S rRNA gene abundance in various samples studied. Significantly higher levels of bacterial DNA was detected in the infected catheters (n = 14) compared to the uninfected catheters (n = 12) (Mann-Whitney test p<0.05). *p<0.05, ns = non-significant (p>0.05). Cath = catheter, U = uninfected, I = infected.

Alpha diversity of the microbiome from the catheter, blood and skin swab

Alpha diversity within the specimens was measured in the contaminant-removed dataset, rarefied to an even sampling depth (catheter = 165 sequences, blood = 137 and skin swab = 96). There was no statistically significant difference (Mann-Whitney test p>0.05) in the microbial richness (as measured by observed OTUs, Fig 2A) or diversity (as estimated by the Shannon diversity index (SDI), Fig 2B) based on CLABSI status for catheter samples. We also found no differences in the richness and diversity between uninfected and infected groups in skin swab and blood samples. Similar results were obtained with the non-rarefied dataset (S3 Fig).

(A) Observed OTUs and (B) the Shannon Diversity Indices are presented in scatter plots. The alpha diversity metrics did not differ between infected and uninfected catheters.

Beta diversity of samples from infected (CLABSI) and uninfected neonates

Multivariate analyses of beta diversity measured by UniFrac distance matrices are presented in principal coordinate analysis (PCoA) plots (Fig 3A–3F). We did not observe significant clustering by the infection status for any of the sample types using unweighted UniFrac distance matrices (Fig 3A–3C) (uninfected vs infected groups: PERMANOVA p>0.05 for all sample types). Similar results were obtained with weighted UniFrac distances (Fig 3D–3F). However, the blood microbiomes of infected subjects clustered separately from the uninfected subjects (see Fig 3C).

PCoA plots of the microbial communities in infected (red circles) and uninfected samples (blue circles) of (A) catheter biofilms, (B) skin swab and (C) blood respectively as measured using unweighted UniFrac distances. Uninfected blood samples are clustered separately from the infected blood samples (see Fig 3C), but there is no clustering identified in the catheter biofilm or skin swab microbial communities. Figs D-F represents scatter plots of the weighted UniFrac distance metrics for the catheter, skin swab and blood microbiomes in uninfected and infected groups. Each circle represents the complete microbial community of a biological sample. The first 2 principal components (PC1and PC2), along with the amount of variation explained are shown in the figures.

Microbial composition and structure

Microbiome composition by specimen type.

The microbial community composition differed by sample type. Based on specimen type, we found a higher relative abundance of the phylum Firmicutes in both catheter biofilm (BH corrected Dunn’s Kruskal-Wallis test p = 0.03) and skin swab (p = 0.02) when compared to the abundance in blood (S4 Fig). One of the major CLABSI bacteria- Staphylococcus spp. was found at a significantly higher abundance in catheters (mean relative abundance = 63%) and skin swabs (59%) than in blood (16%) samples (p<0.05 for both comparisons, S4 and S5 Figs). Additionally, the mean abundance of Streptococcus was significantly higher in catheters (6%) compared to the mean abundance in skin swabs (0.01%) (p = 0.0001). Other genera belonging to Firmicutes, such as Enterococcus and Anaerococcus were only present in catheter biofilm samples (see S4 and S5 Figs).

Catheter microbiomes of CLABSI and non-CLABSI neonates.

We found no statistically significant differences in relative abundance of the bacterial phyla between infected and uninfected catheters (Mann-Whitney test p>0.05, Fig 4A). However, a group of bacteria significantly differ in their relative abundances between infected and uninfected catheters (p<0.05, see S3 Table and Fig 4B for details) at the genus level. Among the genera with ≥1% mean relative abundances across the group, we found a significantly lower abundance of Bradyrhizobium (p = 0.001) and Cloacibacterium (p = 0.005) in infected catheters when compared to the uninfected catheters (Fig 4C and 4D, respectively). In contrast, the relative abundance of Proteus was significantly higher (p = 0.01) in infected catheters than the non-infected catheters (Fig 4F). In the case of taxa with <1% relative abundances, Staphylococcaceae_unclassified (assigned to a single OTU-337) had a higher abundance (p = 0.034) in the infected catheters compared to the uninfected catheters (Fig 4G), among others (S3 Table).

Bar plots representing the taxonomic composition of the catheter biofilm microbiota at the (A) phylum and (B) genus level for uninfected (n = 12) and infected (n = 15) catheters. Taxa with a mean relative abundance <1% are grouped together. Comparisons between infected and uninfected groups used a Mann-Whitney test. There was a significantly (p<0.05) lower abundance of Bradyrhizobium, Cloacibacterium, and Sphingomonas in infected catheters when compared to uninfected catheters (C-E). In contrast, infected catheter samples had a higher proportion of (F) Proteus and (G) unclassified Staphylococcaceae in comparison to the uninfected catheters.

Staphylococcus, the predominant bacteria in skin samples, was found with a relative abundance of more than 50% in both infected and non-infected catheter microbiomes.

Skin swab microbiomes in CLABSI and non-CLABSI neonates.

Skin swab microbiomes of CLABSI neonates did not differ significantly from that of the non-CLABSI individuals (Mann-Whitney test p>0.05) both at the phylum and genus level (Fig 5A and 5B), with the exception of a very rarely abundant family level taxa- unclassified Oxalobacteraceae.

Columns represent the average relative abundance of bacterial taxa at (A) phylum and (B) genus level for uninfected (n = 5) and infected (n = 6) skin swabs collected from the non-CLABSI and CLABSI neonates, respectively. Bar plots showing the relative abundances of bacteria in individual blood samples collected from (C) blood culture negative (non-CLABSI) and (D) blood culture positive (CLABSI) neonates (identified on the x-axis). The results of the blood microbiomes are not combined for uninfected and infected groups because each individual within the group are very different in terms of their blood microbiome composition.

Microbiomes in blood samples of CLABSI and non-CLABSI neonates.

Among the six blood samples (collected from six different individuals) included in the final analysis of the blood microbiomes, three samples (013B, 051B and 056B) were ‘culture-negative’ by traditional blood culture methods and reported as uninfected (i.e. non-CLABSI). However, 16SV4 rRNA sequencing of these non-CLABSI blood samples revealed the presence of many bacterial taxa, including Bacteroides, Clostridiales, Helicobacter, and unclassified Enterobacteriaceae (Fig 5C). On the other hand, 16S sequencing of the ‘culture-positive’ blood samples (n = 3) revealed all the bacterial genera identified by traditional culture-based methods (Fig 5D).

Catheter microbiomes by type of nutrition.

When comparing the two predominant nutritional groups of TPN and enteral feeds (MEBM and DEBM combined), we found multiple bacterial taxa with significantly different relative abundances (Mann-Whitney test p<0.05) in the catheter microbiomes between the groups (S4 Table). However, both alpha and beta diversity of the catheter microbiomes between the groups was not different (Mann-Whitney test of Shannon index p>0.05, unweighted UniFrac PERMANOVA p> 0.05).


Infection Control

Given the need for often extensive and close contact between patients and healthcare personnel, a 14-day quarantine period continues to be recommended for patients receiving healthcare and healthcare personnel with exposures to SARS-CoV-2 warranting quarantine 1 or work restrictions, respectively. This option maximally reduces post-quarantine transmission risk and is the strategy with the greatest collective experience at present.

Alternatives to the 14-day quarantine period are described in the Options to Reduce Quarantine for Contacts of Persons with SARS-CoV-2 Infection Using Symptom Monitoring and Diagnostic Testing. Healthcare facilities could consider these alternatives as a measure to mitigate staffing shortages, space limitations, or PPE supply shortages but, due to the special nature of healthcare settings (e.g., patients at risk for worse outcomes, critical nature of healthcare personnel, challenges with social distancing), not as a preferred option.

Healthcare facilities should understand that shortening the duration of work restriction or patient quarantine might pose additional transmission risk. They should also counsel patients and healthcare personnel about the need to monitor for and immediately self-isolate if symptoms occur during the 14 days after their exposure and the importance of adhering to all recommended non-pharmaceutical interventions.

1 In healthcare settings, patients under quarantine are typically isolated in a single-person room and cared for by healthcare personnel using all PPE recommended for a patient with suspected or confirmed SARS-CoV-2 infection. However, these patients should not be cohorted with patients with SARS-CoV-2 infection unless they are also confirmed to have SARS-CoV-2 infection through testing.

CDC currently recommends that asymptomatic patients and residents who have recovered and are within 3 months of a positive test for SARS-CoV-2 infection may not need to be quarantined or tested following re-exposure to SARS-CoV-2. However, there might be clinical scenarios in which the certainty about a prior infection or the durability of the immune response exist, for which providers could consider testing for SARS-CoV-2 and recommending quarantine following an exposure that occurs less than 3 months after their initial infection. Examples could include:

  • Patients or residents with underlying immunocompromising conditions (e.g., patient after organ transplantation) or who become immune compromised (e.g., receive chemotherapy) in the 3 months following SARS-CoV-2 infection and who might have an increased risk for reinfection. However, data on which specific conditions may lead to higher risk and the magnitude of risk are not available.
  • Patients or residents for whom there is concern that their initial diagnosis of SARS-CoV-2 infection might have been based on a false positive test result (e.g., resident was asymptomatic, antigen test positive, and a confirmatory nucleic acid amplification test (NAAT) was not performed).
  • Patients or residents for whom there is evidence that they were exposed to a novel SARS-CoV-2 variant (e.g., exposed to a person known to be infected with a novel variant) for which the risk of reinfection might be higher

CDC continues to actively investigate the frequency of reinfection and the circumstances surrounding these episodes, including the role that new variants might play in reinfection, and will adjust guidance as necessary as more information becomes available.

Yes. To keep patients and healthcare personnel (HCP) healthy and safe, CDC&rsquos infection prevention and control guidance applies to all settings where healthcare is delivered. However, as with any guidance, facilities can tailor certain recommendations to their setting. For example, inpatient psychiatric care includes communal experiences and group activities that may need to continue. If so, these activities might need to be adapted to align with social distancing recommendations. Other recommended infection control measures (for example, ensuring access to alcohol-based hand sanitizer, cohorting patients with COVID-19 and assigning dedicated staff, or implementing universal source control measures) might not be safe or appropriate to implement in all locations or for all patients due to security and behavioral concerns.

Challenges and potential solutions specific to behavioral health settings might include:

  • Cohorting
    • Challenge: To prevent transmission, it is generally recommended that patients with COVID-19 be transferred to a separate area of the facility where they can be cared for by dedicated HCP. Because of security concerns or specialized care needs, it might not be possible to cohort certain patients together or change HCP assigned to their care.
    • Potential Solutions: When cohorting is not possible, implement measures to maintain social distancing (at least 6 feet) between patients with COVID-19 and others on the unit. Ideally, this would include a separate bathroom for COVID-19 patients. Ensure HCP wear all recommended personal protective equipment (PPE) when caring for patients with suspected or confirmed COVID-19.
    • Challenge: Group counseling, therapy, and discussion sessions are a critical component of psychiatric treatment and care plans, but the traditional set-up for these activities is not compatible with social distancing recommendations.
    • Potential Solutions: When possible, use virtual methods, or decrease group size so social distancing can be maintained. In the event that COVID-19 is transmitted in the facility, sessions should stop or move to a video discussion forum until additional infection prevention measures are in place to stop the spread.
    • Challenge: For some patients, the use of cloth face coverings or facemasks might pose an additional danger or may cause distress. Some patients may be unable or unwilling to use them as intended. Elastic and cloth straps can be used for strangling oneself or others, and metal nasal bridges can be used for self-harm or as a weapon.
    • Potential Solutions: Consider allowing patients at low risk for misuse to wear cloth face coverings or facemasks, with a preference for those with short ear-loops rather than longer ties. Consider use of cloth face coverings or facemasks during supervised group activities. Ensure that HCP interacting with patients who cannot wear a cloth face covering or facemask are wearing eye protection and a facemask (or a respirator if the patient is suspected to have COVID-19 and respirators are available).
    • Challenge: While alcohol-based hand sanitizer (ABHS) containing 60-95% alcohol is an important tool to increase adherence to hand hygiene recommendations, ABHS must be used carefully in psychiatric facilities to ensure it is not ingested by patients.
    • Potential Solutions: Consider not placing ABHS in patients&rsquo rooms in psychiatric facilities, nor in locations where the patients have unsupervised access. Encourage frequent hand washing with soap and water for patients and HCP. Consider providing personal, pocket-sized ABHS dispensers for HCP.
    • Challenge: As part of social distancing, communal dining is generally not recommended. However, eating needs to remain supervised due to the potential for self-harm with eating utensils and because commonly used psychiatric medications may cause side effects (e.g., tardive dyskinesia, dysphagia, hypo- and hypersalivation) that increase choking risk for patients.
    • Potential Solutions: One option is to position staff in patients&rsquo rooms to monitor their dining. Another option is to allow communal dining in shifts so that staff can monitor patients while ensuring they remain at least 6 feet apart. A third option is to have patients sit in appropriately spaced chairs in the hallway outside their rooms so they can be monitored while they eat.
    • Challenge: A higher proportion of psychiatric patients smoke cigarettes compared to the general population. Patients might congregate in outdoor smoking spaces without practicing appropriate social distancing.
    • Potential Solutions: Limit the number of patients allowed to access smoking spaces at the same time, and position staff to observe and ensure patients are practicing appropriate physical distancing.

    Facilities should follow the reporting requirements of their state or jurisdiction. Those regulated by the Centers for Medicare and Medicaid Services (CMS) (e.g., nursing homes) should also follow all CMS requirements external icon , which are being updated to include new requirements for reporting to CDC and to residents and their representatives.

    In addition, CDC recommends that health departments be promptly notified about:

    • Residents or healthcare personnel (HCP) with suspected or confirmed COVID-19,
    • Residents with severe respiratory infection resulting in hospitalization or death, and
    • &ge 3 residents or HCP with new-onset respiratory symptoms within 72 hours of each other.

    These could signal an outbreak of COVID-19 or other respiratory disease in the facility. The health department can provide important guidance to assist with case finding and halting transmission.

    The facility should also have a plan and mechanism to regularly communicate with residents, family members, and HCP, including if cases of COVID-19 are identified in the facility. Often, information in nursing homes is communicated through town hall meetings and staff meetings, along with letters or emails. However, during the COVID-19 pandemic, in-person gatherings should not occur. Instead, communication should occur through virtual meetings over phone or web platforms. These should be supplemented with written communications that provide contact information for a staff member who can respond to questions or concerns. Communications should include information describing the current situation, plans for limiting spread within the facility, and recommended actions they can take to protect themselves and others. Facilities should make this information available in a timely manner and offer periodic updates as the situation develops and more information becomes available.

    No. For patients hospitalized with SARS-CoV-2 infection, decisions about discharge from the hospital should be based on their clinical status and the ability of an accepting facility to meet their care needs and adhere to recommended infection prevention and control practices. Decisions about hospital discharge are distinct from decisions about discontinuation of Transmission-Based Precautions.

    For patients with suspected or confirmed SARS-CoV-2 infection, decisions about discontinuing Transmission-Based Precautions should be based on the strategies outlined here. The test-based strategy is recommended only for use in limited circumstances.

    If a patient with suspected or confirmed SARS-CoV-2 infection has not met criteria for discontinuing Transmission-Based Precautions, they should be transferred to a facility with the ability to adhere to infection prevention and control recommendations for the care of residents with SARS-CoV-2 infection, including placement in a unit or area of the facility designated to care for residents with SARS-CoV-2 infection and provision of recommended personal protective equipment to healthcare personnel.

    If the patient has met the criteria for discontinuing Transmission-Based Precautions, they do not require additional restrictions.

    A patient hospitalized for non-COVID-related illnesses who is not known to have SARS-CoV-2 infection can be transferred to a nursing home without testing. To ensure a patient was not exposed and might subsequently develop SARS-CoV-2 infection, nursing homes should place the patient in Transmission-based Precautions in a separate observation area or in a single-person room for 14 days after admission.

    As part of universal source control measures, all residents (including those described in the scenarios above) should wear a cloth face covering or facemask (if tolerated) whenever they leave their room.

    As part of routine practices, healthcare personnel (HCP) should be applying Standard Precautions. HCP should always deliberately assess potential risks of exposure to infectious material before engaging in activities and procedures in healthcare delivery. Based on their risk assessment, safe work practices, including engineering controls that reduce the release of infectious material, administrative controls, and use of personal protective equipment (PPE) should be implemented at the point of care according to CDC guidelines and standards of practice for the activity performed.

    To reduce SARS-CoV-2 exposure during the COVID-19 pandemic, CDC recommends that facilities:

    • consider nonoperative approaches when feasible
    • minimize the use of procedures or techniques that might produce infectious aerosols when feasible
    • minimize the number of people in the operating or procedure room to reduce exposures
    • use the extent of community transmission and an assessment of the likelihood for patient harm if care is delayed to make decisions about cancelling or postponing elective surgeries and procedures and
    • implement universal source control measures, which includes having patients wear a cloth face covering (as tolerated) and having HCP wear a facemask at all times while they are in the healthcare facility.

    If surgery or procedures cannot be postponed, HCP caring for patients with suspected or confirmed COVID-19 should adhere to all recommended infection prevention and control practices for COVID-19. This includes:

    • Using all recommended PPE: an N95 or equivalent or higher-level respirator (or facemask if respirators are not available), eye protection, gloves, and a gown.
      • Respirators with exhalation valves should not be used during surgical procedures as unfiltered exhaled breath would compromise the sterile field.
      • If shortages exist, N95 or equivalent or higher-level respirators should be prioritized for procedures involving higher risk techniques (e.g., that generate potentially infectious aerosols) or that involve anatomic regions where viral loads might be higher (e.g., nose and throat, oropharynx, respiratory tract).

      Because SARS-CoV-2 can be transmitted by individuals who are infected but do not have symptoms, some infected individuals will not be identified by screening for clinical signs and symptoms. HCP providing surgical or procedural care to patients not suspected of having SARS-CoV-2 infection should use a tiered approach based on the level of community transmission to inform the need for universal eye protection and respirator use. HCP should continue to use eye protection or an N95 or equivalent or higher-level respirator whenever recommended for patient care as a part of Standard or Transmission-Based Precautions.

      In addition to the use of universal PPE and source control in healthcare settings, targeted SARS-CoV-2 testing of patients without signs or symptoms of COVID-19 might be used to identify those with asymptomatic or pre-symptomatic SARS-CoV-2 infection and further reduce risk for exposures in some healthcare settings. Depending on guidance from local and state health departments, testing availability, and how rapidly results are available, facilities can consider implementing pre-admission or pre-procedure diagnostic testing with authorized nucleic acid or antigen detection assays for SARS-CoV-2.
      Testing results might inform decisions about rescheduling elective procedures or about the need for additional Transmission-Based Precautions when caring for the patient. Limitations of using this testing strategy include obtaining negative results in patients during their incubation period who later become infectious and false negative test results, depending on the test method used.

      CDC&rsquos guidance to use NIOSH-approved N95 disposable filtering facepiece or higher level respirators when providing care for patients with suspected or known COVID-19 is based on the current understanding of SARS-CoV-2 and related respiratory viruses.

      Current data suggest that close-range aerosol transmission by droplet and inhalation, and contact followed by self-delivery to the eyes, nose, or mouth are likely routes of transmission. Long-range aerosol transmission, such as is seen with measles, has not been a feature of SARS-CoV-2.

      Potential routes of close-range transmission include splashes and sprays of infectious material onto mucous membranes and inhalation of infectious virions exhaled by an infected person. The relative contribution of each of these is not known for SARS-Co-V-2.

      Facemasks commonly used during surgical procedures will provide barrier protection against droplet sprays contacting mucous membranes of the nose and mouth, but they are not designed to protect wearers from inhaling small particles. N95 and higher level respirators, such as other disposable filtering facepiece respirators, powered air-purifying respirators (PAPRs), and elastomeric respirators, provide both barrier and respiratory protection because of their tight fit and filtration characteristics.

      Respirators should be used as part of a respiratory protection program that provides staff with medical evaluations, training, and fit testing.

      Although facemasks are routinely used for the care of patients with common viral respiratory infections, N95 or higher level respirators are routinely recommended for emerging pathogens like SARS CoV-2, which have the potential for transmission via small particles, the ability to cause severe infections, and no specific treatments or vaccines.

      CDC recommendations acknowledge the current challenges with limited supplies of N95s and other respirators. Facilities that do not have sufficient supplies of N95s and other respirators for all patient care should prioritize their use for activities and procedures that pose high risks of generating infectious aerosols and use facemasks for care that does not involve those activities or procedures. Detailed strategies for optimizing the supply of N95 respirators are available on the CDC website. Once availability of supplies is reestablished, the guidance states that the use of N95 and higher level respirators should resume.

      In general, transport and movement of a patient with suspected or confirmed SARS-CoV-2 infection outside of their room should be limited to medically essential purposes. If being transported outside of the room, such as to radiology, healthcare personnel (HCP) in the receiving area should be notified in advance of transporting the patient. For transport, the patient should wear a facemask or cloth face covering (if tolerated) to contain secretions and be covered with a clean sheet.

      If transport personnel must prepare the patient for transport (e.g., transfer them to the wheelchair or gurney), transport personnel should wear all recommended PPE (gloves, a gown, respiratory protection that is at least as protective as a fit tested NIOSH-certified disposable N95 filtering facepiece respirator or facemask&mdashif a respirator is not available&mdashand eye protection [i.e., goggles or disposable face shield that covers the front and sides of the face]). This recommendation is needed because these interactions typically involve close, often face-to-face, contact with the patient in an enclosed space (e.g., patient room). Once the patient has been transferred to the wheelchair or gurney (and prior to exiting the room), transporters should remove their gown and gloves and perform hand hygiene.

      The transporter should continue to wear a respirator or facemask. The continued use of eye protection by the transporter is also recommended if there is potential that the patient might not be able to tolerate their facemask or cloth face covering for the duration of transport. Additional PPE should not be required unless there is an anticipated need to provide medical assistance during transport (e.g., helping the patient replace a dislodged facemask).

      After arrival at their destination, receiving personnel (e.g., in radiology) and the transporter (if assisting with transfer) should perform hand hygiene and wear all recommended PPE. If still wearing their original respirator or facemask and eye protection, the transporter should take care to avoid self-contamination when donning the remainder of the recommended PPE. This cautious approach will be refined and updated as more information becomes available and as response needs change in the United States.

      Interim guidance for EMS personnel transporting patients with confirmed or suspected SARS-CoV-2 infection is available here. EMS personnel should wear all recommended PPE because they are providing direct medical care and in close contact with the patient for longer periods of time.

      In general, only essential personnel should enter the room of patients with SARS-CoV-2 infection. Healthcare facilities should consider assigning daily cleaning and disinfection of high-touch surfaces to nursing personnel who will already be in the room providing care to the patient. If this responsibility is assigned to EVS personnel, they should wear all recommended PPE when in the room. PPE should be removed upon leaving the room, immediately followed by performance of hand hygiene.

      After discharge, terminal cleaning can be performed by EVS personnel. They should delay entry into the room until time has elapsed for enough air changes to remove potentially infectious particles. After this time has elapsed, EVS personnel can enter the room and should wear a facemask (for source control) along with a gown and gloves when performing terminal cleaning. Eye protection should be added if splashes or sprays during cleaning and disinfection activities are anticipated or otherwise required based on the selected cleaning products. Shoe covers are not recommended at this time for personnel caring for patients with SARS-CoV-2 infection.

      Some procedures performed on patients are more likely to generate higher concentrations of infectious respiratory aerosols than coughing, sneezing, talking, or breathing. These aerosol generating procedures (AGPs) potentially put healthcare personnel and others at an increased risk for pathogen exposure and infection.

      Development of a comprehensive list of AGPs for healthcare settings has not been possible, due to limitations in available data on which procedures may generate potentially infectious aerosols and the challenges in determining if reported transmissions during AGPs are due to aerosols or other exposures.

      There is neither expert consensus, nor sufficient supporting data, to create a definitive and comprehensive list of AGPs for healthcare settings.

      Commonly performed medical procedures that are often considered AGPs, or that create uncontrolled respiratory secretions, include:

      • open suctioning of airways
      • sputum induction
      • cardiopulmonary resuscitation
      • endotracheal intubation and extubation
      • non-invasive ventilation (e.g., BiPAP, CPAP)
      • bronchoscopy
      • manual ventilation

      Based on limited available data, it is uncertain whether aerosols generated from some procedures may be infectious, such as:

      *Aerosols generated by nebulizers are derived from medication in the nebulizer. It is uncertain whether potential associations between performing this common procedure and increased risk of infection might be due to aerosols generated by the procedure or due to increased contact between those administering the nebulized medication and infected patients.

      References related to aerosol generating procedures:

      Tran K, Cimon K, Severn M, Pessoa-Silva CL, Conly J (2012) Aerosol Generating Procedures and Risk of Transmission of Acute Respiratory Infections to Healthcare Workers: A Systematic Review. PLoS ONE 7(4) https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3338532/#!po=72.2222external iconexternal icon external icon ).

      Although spread of SARS-CoV-2 is believed to be primarily via respiratory droplets, the contribution of small respirable particles to close proximity transmission is currently uncertain. Airborne transmission from person-to-person over long distances is unlikely.

      The amount of time that the air inside an examination room remains potentially infectious is not known and may depend on a number of factors including the size of the room, the number of air changes per hour, how long the patient was in the room, if the patient was coughing or sneezing, and if an aerosol-generating procedure was performed. Facilities will need to consider these factors when deciding when the vacated room can be entered by someone who is not wearing PPE.

      For a patient who was not coughing or sneezing, did not undergo an aerosol-generating procedure, and occupied the room for a short period of time (e.g., a few minutes), any risk to HCP and subsequent patients likely dissipates over a matter of minutes. However, for a patient who was coughing and remained in the room for a longer period of time or underwent an aerosol-generating procedure, the risk period is likely longer.

      For these higher risk scenarios, it is reasonable to apply a similar time period as that used for pathogens spread by the airborne route (e.g., measles, tuberculosis) and to restrict HCP and patients without PPE from entering the room until sufficient time has elapsed for enough air changes to remove potentially infectious particles.

      In addition to ensuring sufficient time for enough air changes to remove potentially infectious particles, HCP should clean and disinfect environmental surfaces and shared equipment before the room is used for another patient.

      CDC has released information about strategies to optimize the supply of isolation gowns. Healthcare facilities should refer to that guidance and implement the recommended strategies to optimize their current supply of gowns. This includes shifting toward the use of washable cloth gowns, if feasible.

      The use of gowns as part of Contact Precautions in the context of MDROs has been implemented primarily to reduce the risk of transmission to other patients rather than to protect healthcare personnel (HCP). Facilities with shortages could consider suspending the use of gowns for the care of patients with endemic MDROs, such as MRSA, VRE, and ESBL-producing Gram-negative bacilli except as required for Standard Precautions. Facilities should assess their local epidemiology to determine which MDROs are considered endemic. Regardless of the use of gowns, HCP at facilities should continue to wear gloves for contact with these patients and their environment. Hand hygiene should continue to be emphasized. Facilities should also attempt to place patients colonized or infected with an MDRO in a private room, if available.

      • Caring for patients who have highly resistant Gram-negative organisms (e.g., carbapenem-resistant Enterobacteriacae) and other MDROs (e.g.,Candida auris) that are not considered endemic: Rather than gowns being donned for every room entry, they should be reserved for use as part of Standard Precautions and also prioritized for high-contact patient care activities that pose highest risk for transfer of pathogens from the patient to HCP. Examples of such high-contact care activities include dressing, bathing/showering, transferring, providing hygiene, changing linens, changing briefs or assisting with toileting, device care or use (central line, urinary catheter, feeding tube, tracheostomy/ventilator), and wound care. To further preserve gowns, HCP are recommended to bundle high-contact care activities as part of individual care encounters. Regardless of the use of gowns, HCP at facilities should continue to wear gloves for contact with these patients and their environment. Hand hygiene should continue to be emphasized. Facilities should also attempt to place patients colonized or infected with an MDRO in a private room, if available.
      • Caring for patients withClostridioides difficileinfections (CDI): Facilities should continue using Contact Precautions (putting on a gown and gloves upon entry into the patient&rsquos room and placing the patient in a private room) for the care of symptomatic patients with CDI. As part of a supplemental strategy to prevent transmission of CDI, some facilities have implemented Contact Precautions for the care of patients at high risk for CDI who have asymptomatic carriage of Clostridioides difficile. There are limited data about the role of asymptomatic carriage in transmission of CDI. In this setting of a critical national shortage of gowns, facilities should consider suspending this approach until the shortage is addressed. Gowns should still be used as part of Standard Precautions.

      Anyone who had prolonged close contact (within 6 feet for a cumulative total of 15 minutes or more over a 24-hour period) with the infected healthcare provider might have been exposed.

      • If the provider had COVID-19 symptoms, the provider is considered potentially infectious beginning 2 days before symptoms first appeared until the provider meets criteria to discontinue Transmission-Based Precautions or Home Isolation.
      • If the provider did not have symptoms, collecting information about when the provider may have been exposed could help inform the period when they were infectious.
        • If an exposure is identified. The provider should be considered potentially infectious beginning 2 days after the exposure until criteria to discontinue Transmission-Based Precautions or Home Isolation are met.
        • If the date of exposure cannot be determined. For the purposes of contact tracing, it is reasonable to use a cutoff of 2 days before the specimen testing positive for SARS-CoV-2 was collected as the starting point, continuing until the criteria to discontinue Transmission-Based Precautions or Home Isolation are met. Although the infectious period is generally accepted to be 10 days after onset of infection, eliciting contacts during the entire 10 days before obtaining the specimen that tested positive for SARS-CoV-2 is likely inefficient. In most situations an exposed provider cannot recall all contacts over the preceding 10 days. Also, because recent data suggest that asymptomatic persons may have a lower viral burden at diagnosis than symptomatic persons, the additional resources required may divert case investigation and contact tracing resources away from activities most likely to interrupt ongoing transmission.

        Contact tracing is generally recommended for anyone who had prolonged close contact with the person with SARS-CoV-2 infection during these time periods. While this question addresses exposure to a potentially infectious provider, the following actions are also recommended if the potentially infectious individual is a patient or visitor.

        Recommended actions for HCP, patients, and visitors:

        • Perform a risk assessment and apply work restrictions for other HCP who were exposed to the infected provider based on whether these HCP had prolonged, close contact and what PPE they were wearing. More detailed information is available in the Interim U.S. Guidance for Risk Assessment and Work Restrictions for Healthcare Personnel with Potential Exposure to COVID-19.
        • Place exposed patients who are currently admitted to the healthcare facility in appropriate Transmission-Based Precautions and monitor them for onset of SARS-CoV-2 infection until 14 days after their last exposure. .
        • Perform contact tracing of exposed patients who are not currently admitted to the healthcare facility and for visitors as described in Health Departments: Interim Guidance on Developing a COVID-19 Case Investigation and Contact Tracing Plan.

        Healthcare facilities should have a process for notifying the health department about known or suspected cases of SARS-CoV-2 infection, and should establish a plan, in consultation with local public health authorities, for how exposures in a healthcare facility will be investigated and how contact tracing will be performed. The plan should address the following:

        • Who is responsible for identifying contacts and notifying potentially exposed individuals?
        • How will such notifications occur?
        • What actions and follow-up are recommended for those who were exposed?

        Contact tracing should be carried out in a way that protects the confidentiality of affected individuals to the extent possible and is consistent with applicable laws and regulations. HCP and patients who are currently admitted to the facility or were transferred to another healthcare facility should be prioritized for notification. These groups, if infected, have the potential to expose a large number of individuals at higher risk for severe disease, or in the situation of admitted patients, be at higher risk for severe illness themselves.

        Information for health departments about case investigation and contact tracing is available in the Health Departments: Interim Guidance on Developing a COVID-19 Case Investigation and Contact Tracing Plan. This guidance could also be helpful to healthcare facilities performing such activities.

        Anyone who had prolonged close contact (within 6 feet for at least 15 minutes) should be considered potentially exposed. The use of a facemask for source control and adherence to other recommended infection prevention and control (IPC) measures (e.g., hand hygiene) by the provider help to reduce the risk of transmission or severe illness. In areas with moderate to substantial community transmission, patients are already at risk for exposure to SARS-CoV-2 due to exposures outside their home and should be alert to the development of signs or symptoms consistent with COVID-19.

        The following should be considered when determining which patients are at higher risk for transmission and might be prioritized for evaluation and testing:

          use by the patient &ndash Mirroring the risk assessment guidance for healthcare personnel, patients not wearing a facemask would likely be at higher risk for infection compared to those that were wearing a facemask.
      • Type of interaction that occurred between the patient and infected provider &ndash An interaction involving manipulation or prolonged close contact with the patient&rsquos eyes, nose, or mouth (e.g., dental cleaning) likely poses higher risk of transmission to the patient compared to other interactions (e.g., blood pressure check).
      • PPE used by infected HCP &ndash HCP wearing a facemask (or respirator) and face shield that extends down below the chin might have had better source control than wearing only a facemask. Note that respirators with exhalation valves might not provide source control.
      • Current status of patient &ndash Is the patient currently admitted to a hospital or long-term care facility? These individuals, if infected, can be at higher risk for severe illness and have the potential to expose large numbers of individuals at risk for severe disease.
      • 1. If HCP have recovered from SARS-CoV-2 infection but have a high-risk exposure within 3 months of their initial infection to a patient with SARS-CoV-2 infection, should they be restricted from work for 14 days after the exposure?

        CDC has posted interim guidance for risk assessment and work restrictions for HCP with potential exposure to SARS-CoV-2. Because of their often extensive and close contact with people who are at high risk for severe illness, this guidance recommends a conservative approach to HCP monitoring and applying work restrictions to prevent transmission from potentially contagious HCP to patients, other HCP, and visitors. Review of currently available evidence suggests that most people do not become re-infected in the 3 months after SARS-CoV-2 infection. Testing of asymptomatic people during this 3-month period is complicated by the fact that some people have detectable virus from their prior infection during this period a positive test during this period may more likely result from a prior infection rather than a new infection that poses risk for transmission.

        In light of this, exposed HCP who are within 3 months of their initial infection, could continue to work, while monitoring for symptoms consistent with COVID-19 and following all recommended infection prevention and control practices (e.g., universal use of well-fitting source control). If symptoms develop, exposed HCP should be assessed and potentially tested for SARS-CoV-2, if an alternate etiology is not identified. Some facilities might still choose to institute work restrictions for asymptomatic HCP following a higher risk exposure, particularly if there is uncertainty about a prior infection or the durability of the person&rsquos immune response. Examples could include:

        • HCP with underlying immunocompromising conditions (e.g., after organ transplantation) or who become immune compromised (e.g., receive chemotherapy) in the 3 months following SARS-Cov-2 infection who might be at increased risk for reinfection. However, data on which specific conditions may lead to higher risk and the magnitude of risk are not available.
        • HCP for whom there is concern that their initial diagnosis of SARS-CoV-2 infection might have been based on a false positive test result (e.g., individual was asymptomatic, antigen test positive, and a confirmatory nucleic acid amplification test (NAAT) was not performed).
        • HCP for whom there is evidence that they were exposed to a novel SARS-CoV-2 variant for which the risk of reinfection might be higher (e.g., exposed to a person known to be infected with a novel variant).

        CDC continues to actively investigate the frequency of reinfection and the circumstances surrounding these episodes, including the role that new variants might play in reinfection, and will adjust guidance as necessary as more information becomes available.

        2. If HCP within 3 months of their initial infection develop symptoms consistent with COVID-19, should they be excluded from work and retested?

        HCP within 3 months of a confirmed SARS-CoV-2 infection who develop symptoms consistent with COVID-19 should be evaluated to identify potential alternative etiologies for their symptoms. If an alternate etiology for the symptoms cannot be identified, they may need to be retested for SARS-CoV-2 infection with the understanding that a positive viral test could represent residual viral particles from the previous infection, rather than new infection. Decisions about the need for and duration of work exclusion should be based upon their suspected diagnosis (e.g., influenza, SARS-CoV-2 infection).

        3. Do HCP within 3 months of their initial infection need to wear all recommended personal protective equipment (PPE) when caring for patients with suspected or confirmed SARS-CoV-2 infection? For example, if there are limited respirators, should respirators be prioritized for HCP who have not been previously infected?

        Regardless of suspected or confirmed immunity, healthcare personnel should always wear all recommended PPE when caring for patients. In situations of PPE shortages, facilities should refer to CDC strategies for optimizing PPE supply. However, as with other infectious diseases (e.g., measles), allocation of available PPE should not be based on whether HCP have been previously infected or have evidence of immunity.

        4. Should HCP within 3 months of their initial infection be preferentially assigned to care for patients with suspected or confirmed SARS-CoV-2 infection?

        While individuals who have recovered from SARS-CoV-2 infection might develop some protective immunity, the duration and extent of such immunity are not known. Staffing decisions should be based on usual facility practices. Any HCP assigned to care for patients with suspected or confirmed SARS-CoV-2 infection, regardless of history of infection, should follow all recommended infection prevention and control practices when providing care. Guidance on mitigating staff shortages is also available.

        Yes. HCP who have any kind of exposure for which home quarantine is recommended should be excluded from work:

        • If HCP are able to quarantine away from the infected individual living with them, they should quarantine at home and not come into work for 14 days following their last exposure to the infected individual.
        • If HCP are not able to quarantine away from the infected individual living with them and have ongoing unprotected exposure throughout the duration of the individual&rsquos illness, they should remain in home quarantine and be excluded from work until 14 days after the infected individual meets criteria for discontinuation of home isolation.
        • If HCP develop SARS-CoV-2 infection while they are in quarantine, they should be excluded from work until they meet all return to work criteria for HCP with SARS-CoV-2 infection.

        Home quarantine and work exclusion of asymptomatic exposed HCP who have recovered from SARS-CoV-2 infection in the prior 3 months might not be necessary. Additional information about this scenario is available here.

        When confirmatory testing is performed on a person with a potential false-positive antigen test result, IPC measures should be maintained pending the result. Additional testing of close contacts can be delayed until results of confirmatory testing are available unless symptomatic individuals are identified.

        • For asymptomatic healthcare personnel (HCP), this includes continuing exclusion from work pending confirmatory testing.
        • For asymptomatic patients or residents, this includes placement on Transmission-Based Precautions in a single room or, if single rooms are not available, remaining in their current room pending results of confirmatory testing. They should not be transferred to a COVID-19 unit or placed in another shared room with new roommates.

        Given the generally lower sensitivity of antigen tests, people with COVID-19&ndashlike symptoms who have a negative antigen test result should have a confirmatory nucleic acid amplification test (NAAT), such as reverse transcriptase polymerase chain reaction (RT-PCR), in most situations. Pending the results of confirmatory testing, maintain the following IPC measures:

        • Patients and residents with COVID-19&ndashlike symptoms should be placed on Transmission-Based Precautions in a single room (not on the COVID-19 unit)
        • HCP with COVID-19&ndashlike symptoms should be excluded from work until the confirmatory test results are available.

        Despite the potential need for confirmatory testing of negative results, the initial use of antigen tests for symptomatic people is still preferred if turnaround time for a NAAT is >2 days because a positive antigen test would initiate contact tracing and implementation of IPC measures.

        CDC has recommended several ways to improve the fit and filtration of masks, including covering a medical facemask with a cloth mask. However, layering masks requires special care in healthcare settings.

        • Although a cloth mask can be used over a medical facemask to improve fit, there may be better alternatives such as framed &ldquofitters&rdquo or using a knot-and-tuck approach to achieve a good fit. If a good fit is achieved using a single medical facemask, additional approaches like adding layers to achieve a better fit might not be necessary.
        • Cloth masks are not personal protective equipment (PPE). They should not be used in place of medical facemasks or NIOSH-approved respirators as part of Standard or Transmission-based Precautions.
        • Wearing a medical facemask or cloth mask over an N95 respirator is not recommended for healthcare personnel in healthcare settings except as a contingency or crisis strategy during extended use of N95 respirators to protect the respirator from contamination during aerosol-generating procedures or procedures that might generate splashes and sprays.
        • Wearing a medical facemask or cloth mask under an N95 respirator is never recommended as it will interfere with the seal.

        In healthcare settings, medical facemasks are used by healthcare personnel for two general purposes.

        • First, as PPE to protect a healthcare worker&rsquos nose and mouth from exposure to splashes, sprays, splatter, and respiratory secretions, such as when treating patients on Droplet Precautions. When used as PPE, medical facemasks should be removed and discarded after each patient encounter unless extended use is being practiced as part of a crisis or contingency capacity strategy.
          • If a cloth mask is used over the medical facemask, it should be removed and laundered after each patient encounter.
          • Cloth masks are not PPE and should not be used alone to protect against splashes and sprays, such as when used while treating patients on Droplet Precautions.

          Once put on, healthcare personnel should not touch their medical facemask or cloth mask. If they touch or adjust their medical facemask or cloth mask, they must perform hand hygiene before and after contact.

          If laundering at the intervals described above cannot be performed, then cloth masks should not be used by healthcare personnel in healthcare settings.

          *Medical facemasks are personal protective equipment (PPE) and are often referred to as surgical masks or procedure masks. Use facemasks according to product labeling and local, state, and federal requirements. FDA-cleared surgical masks are designed to protect against splashes and sprays and are prioritized for use when such exposures are anticipated, including surgical procedures. Facemasks that are not regulated by FDA, such as some procedure masks, which are typically used for isolation purposes, may not provide protection against splashes and sprays.


          Acknowledgements

          We thank Daniel Sdicu for help with dark-field microscopy and preliminary experiments as well as Dr. David M. Ojcius for providing some of the bacteria controls used in this study. We also appreciate the help of Dr. Tsui-Yin Wong during this study. The authors’ work is supported by Primordia Institute of New Sciences and Medicine by grants from Chang Gung Medical Research Projects (CLRPD1A0011, CLRPD1C0011-3, and QZRPD88E), Ming Chi University of Technology (0XB0), the Ministry of Education of Taiwan (EMRPD1B047), and the National Science Council of Taiwan (101-2632-B-182-001-MY3).


          New insight into selective binding properties of infectious HIV

          Free infectious HIV-1 is widely thought to be the major form of the virus in the blood of infected persons. U.S. Military HIV Research Program (MHRP) researchers, however, have demonstrated that essentially all of the infectious virus particles can bind to the surface of red blood cells isolated from each of 30 normal (non-infected) human donors.

          The results were published on December 15 in PLoS One. The lead investigators, Dr. Zoltan Beck and Dr. Carl Alving, researchers with MHRP in the Division of Retrovirology, Walter Reed Army Institute of Research (WRAIR), explain that the data show that although infectious HIV-1 virus particles that bind to red blood cells comprise only a small amount, perhaps as little as a mean of 2.3% of a typical HIV-1 preparation, erythrocyte-bound HIV-1 is then approximately 100-fold more infectious than free (non-cell-bound) HIV-1 for infection of target cells.

          The study concludes that infectious virions constitute only a small fraction of a typical HIV-1 preparation and that, in a laboratory setting, all of the infectious virions can bind to red blood cells and other non-permissive cells (i.e., cells that cannot be infected). If this is true in HIV-infected humans it could mean that red blood cell-bound HIV-1 might be more important than free virus for transmission of infectious HIV-1 to target cells that can be infected.

          Dr. Alving says, "If the same behavior of binding of infectious HIV-1 to red blood cells occurs in humans, it might be possible that red blood cell-bound infectious virions are protected from degradation or immune attack."

          Dr. Beck adds, "This study suggests that erythrocytes might serve as an important, and perhaps hidden, reservoir for infectious HIV-1 virions."


          Detection of Streptococcus mutans Genomic DNA in Human DNA Samples Extracted from Saliva and Blood

          Caries is a multifactorial disease, and studies aiming to unravel the factors modulating its etiology must consider all known predisposing factors. One major factor is bacterial colonization, and Streptococcus mutans is the main microorganism associated with the initiation of the disease. In our studies, we have access to DNA samples extracted from human saliva and blood. In this report, we tested a real-time PCR assay developed to detect copies of genomic DNA from Streptococcus mutans in 1,424 DNA samples from humans. Our results suggest that we can determine the presence of genomic DNA copies of Streptococcus mutans in both DNA samples from caries-free and caries-affected individuals. However, we were not able to detect the presence of genomic DNA copies of Streptococcus mutans in any DNA samples extracted from peripheral blood, which suggests the assay may not be sensitive enough for this goal. Values of the threshold cycle of the real-time PCR reaction correlate with higher levels of caries experience in children, but this correlation could not be detected for adults.

          1. Introduction

          Caries remains the most prevalent noncontagious infectious disease in the world [1] and genetics susceptibility to the disease has become the focus of some research groups that aim to provide new strategies for addressing the problem. Field studies have been immensely facilitated by the development of approaches that allow DNA to be obtained from saliva samples [2]. These samples can then be kept at room temperature for several days to months until extractions can happen in the laboratory. One of the challenges of this line of work is that genetics susceptibility to caries can be masked by the environmental influences to this disease, such as microbial infection, types of diet, and exposure to fluorides.

          In regards to microbial colonization, Streptococcus mutans is the main species involved with the initiation of the disease [reviewed by [3]]. Consequently, one possibility is that individual susceptibility to colonization by Streptococcus mutans will impact future caries experience. However, the traditional quantification of Streptococcus mutans with mitis-salivarius-bacitracin agar medium [4] is laborious and requires direct cultivation of plaque samples. A PCR-based method targeting gtf (glucosyltransferase) genes of Streptococcus mutans was developed as an alternative way to quantify the bacterial infection in humans [5] that is useful as a practical diagnosis system of Streptococcus mutans infection.

          This work had two main objectives. Since we have access to human DNA samples from saliva, in theory these samples also contain genomic copies of the oral microbial colonization of subjects at the day of sample collection. Therefore, we used the PCR-based method for detecting gtf genes of Streptococcus mutans as the way to define if subjects were colonized by Streptococcus mutans and to test how this data correlates with caries experience. Theinformation could subsequently aidour future genetics studies and allow the inclusion of Streptococcus mutans colonization as a covariate in the analysis. The second goal involved detecting genomic DNA copies of Streptococcus mutans in human DNA samples extracted from blood. Since Streptococcus mutans can be detected in heart valve and atheromatous plaque samples [6, 7], we hypothesize it also can be detected in the circulation. Westudied human DNA samples extracted from peripheral blood to test if genomic DNA copies of Streptococcus mutans can be detected by the PCR-based method developed by Yano et al. [5].

          2. Material and Methods

          2.1. Human DNA Samples

          All samples evaluated in this study were obtained after approval by the Institutional Review Boards from the University of Pittsburgh, Istanbul University, CEMIC (Argentina), and CONEP (Brazil) and written informed consent was obtained from each subject. A total of 1,424 DNA samples were included in this study and they were available from a number of datasets.

          (1) From the University of Pittsburgh School of Dental Medicine Dental Registry and DNA Repository (DRDR), 666 DNA samples extracted from whole saliva were utilized. These samples are from consented individuals from Pittsburgh and surrounding regions with ages ranging from 4 to 89 years (average 42.9 years). Individuals that are part of the registry match the demographic distribution of the city of Pittsburgh (approximately 70% White, 20% African American, and the remaining other groups). Approximately 60% of the subjects are females. Most of the individuals are from lower socioeconomic stratum, based on their insurability.

          (2) From the Center for Oral Health Disparities in Appalachia (COHRA), 174 DNA samples extracted from whole blood and 44 from saliva were utilized. These samples were from consented families recruited in several sites of rural Pennsylvania and West Virginia. The DNA samples from whole blood were from individuals with ages ranging from 1 to 68 years (average 23.2 years), and the DNA samples from saliva were from children, ages ranging from 1 to 11 years (average 3.3 years).This study population includes a range of socio-economic status (median annual household income less than $25,000), and is fairly representative of the general Appalachian population, which ranks very low compared with the rest of the nation in terms of many oral health measures and access to oral health care. All individuals included in this analysis were White with ratio male:female almost 1.0.

          (3) From Istanbul, 175 DNA samples extracted from whole saliva were utilized. These samples are from children whose parents' consented participation in the study. These children were 5 to 6 years of age and 85 were caries-free. These individuals were recruited in the Pedodontics Clinics of Istanbul University and daycare facilities in the city of Istanbul. Seventy-nine were males and 94 females.

          (4) From Pittsburgh, 158 DNA samples extracted from whole saliva that did not overlap with the samples from the Dental Registry and DNA Repository were also utilized. These samples were from consented individuals evaluated as a requirement for the University of Pittsburgh School of Dental Medicine students taking the Cariologycourse. These individuals have ages ranging from 13 to 82 years (average 43.3 years) and their characteristics are very similar to the ones described above for the DRDR sampling.

          (5) From Guatemala, 109 DNA samples extracted from whole saliva were utilized. These samples are from consented families with children born with oral clefts and controls who received care during a medical mission sponsored by the nonprofit organization Children of the Americas. These samples are from individuals with ages ranging from 14 to 60 years (average 28 years). Forty-five were males and 64 females. Samples from individuals born with clefts were not included in the present study since there is a suggestion these individuals may have a higher incidence of caries.

          (6) From Argentina, 98 DNA samples extracted from whole saliva were utilized. These samples are from consented families with children born with oral clefts living in the Patagonian region, from individuals with ages ranging from 10 to 72 years (average 31.5 years). Samples from individuals born with clefts were not included since there is a suggestion that these individuals may have a higher incidence of caries. This study population is basically the admixture of Amerindian Mapuches and Spaniards and come from a lower socioeconomic stratum. The ratio male:female is almost 1.0.

          DMFT/dmft (Decayed, Missing due to caries, Filled Teeth) scores were available for all DNA samples utilized in this study and were obtained as recommended by the World Health Organization [1]. They were collected according to international standards. A higher ratio of active carious lesions was seen in younger subjects. For the 174 DNA samples extracted from whole blood, semiquantitative values of Streptococcus mutans were also available (assessed from saliva of the same subjects with Dentocult SM Strip mutans, Orion Diagnostica Oy, P.O.Box 83, Espoo, Finland). All 1 424 DNA samples were successfully tested before in other PCR-based genotyping approaches.

          2.2. DNA Extraction

          DNA was extracted from saliva samples using the manufacturer's protocol for manual purification of DNA from 4.0 mL, PD-PR-015 Issue 2.0. Saliva samples had been previously stored at room temperature for up to 3 months in the Oragene vials until DNA extraction. According to the manufacturer of the vials, saliva DNA is stable for over 2 years at room temperature [8]. The entire saliva sample was extracted with reagent volumes adjusted to maximize the amount of DNA recovered. Briefly, samples were mixed by inversion, and then incubated overnight at 50°C. Samples were transferred to a centrifuge tube and mixed with Oragene purifier, incubated on ice, then centrifuged at 3000 × g for 20 minutes to pellet the denatured protein. The supernatant was transferred to a new tube and DNA was precipitated by adding an equal volume of 100% ethanol. The DNA pellet was washed with 70% ethanol, dried, and resuspended with TE buffer. DNA was incubated at 50°C for 1 hour, followed by incubation at room temperature overnight to ensure complete rehydration. A high-speed centrifugation step at 15,000 × g was performed to remove additional impurities.

          DNA was extracted from blood samples using QIAamp DNA Mini Kit according to the manufacturer’s instructions.

          2.3. Real-Time PCR Assay

          The assay was based on the experiment developed by Yano et al. [5]. In that work, DNA was extracted from whole saliva from human subjects. Yano et al. [5] validated this method using the standard culture approach as a parameter. They reported that these assay results in regards of measuring Streptococcus mutans are strongly correlated with the results obtained from culture. Furthermore, the sensitivity of both methods is very similar, with the real-time PCR able to detect the presence of about 800 copies of genomic DNA from Streptococcus mutans. The assay however does not discriminate the specific Streptococcus mutans serotypes c, e, or f. Primers used in the assay anneal to conserved regions of gtfB and gtfC genes of Streptococcus mutans, and amplify 415 base pair DNA fragments from both genes.

          Real-time PCR was performed by the use of the ABI PRISM 7900HT Fast Real-Time PCR System (Applied Biosystems). Each reaction tube contained 10 μL of reaction mixture, including 1 X SYBR Green PCR buffer, 0.025 U/uL of AmpliTaqGold DNA polymerase, 0.01 U/uL of AmpErase UNG (uracil N-glycosylase), 1.2 mM of each of the dNTPs, 3 mM MgCL2 (SYBR Green PCR Core Reagents, Applied Biosystems), 2 μL of human DNA extracted from saliva or blood samples and 0.8 mM of each primer specific to Streptococcus mutans (forward 5′AGCCATGCGCAATCAACAGGTT3′ and reverse 5′CGCAACGCGAACATCTTGATCAG3′). The specificity of these primers was tested previously [5] and Streptococcus mutans genomic DNA (Streptococcus mutans ATCC 25175) was included in all reactions as positive control and standard DNA curves were generated. The cycling conditions were 2 minutes at 50°C for uracil N-glycosylase (this treatment prevents carryover cross-contamination by digesting uracil-containing fragments generated prior the PCR assay), 10 minutes at 95°C for activation of AmpliTaqGold, 40 cycles of 15 seconds at 95°C for denaturation and 1 minute at 68°C for annealing and extension. Values of the threshold cycle (Ct) above zero were considered positive for Streptococcus mutans infection based on the successful amplification of the target sequence. These values were correlated with DMFT scores and alpha of 0.05 was considered statistically significant.

          3. Results

          Our results were compatible with expected values obtained from the validation procedures described by Yano et al. [5]. A subset of samples were tested multiple times at different time points and results agreed. Streptococcus mutans genomic DNA was detected in samples from human saliva, both in caries-free individuals and in individuals with previous/current caries experience (Table 1). However, genomic DNA copies from Streptococus mutans could not be detected in DNA samples from human peripheral blood (Table 2). These samples were obtained from both adults and children with various levels of caries experience (Table 3). When DMFT/dmft scores were correlated to the values of the threshold cycles of the real-time PCR experiment, statistically significant correlations were only found in the groups comprised exclusively of samples from children (Table 2). Stratifying the data analysis of the adult samples by age did not substantially change the results.

          DMFT/dmft averagers statisticsT statisticsDegrees of freedom*Two-tailed

          4. Discussion

          Any study related to the etiology of caries needs to consider the multifactorial nature of the disease. Microbial colonization is a major factor that modulates the initiation of the disease and always needs to be considered. In the case of our studies, in which we have DNA samples extracted from human saliva, the real-time PCR assay developed by Yano et al. [5] to identify the presence of genomic DNA copies of Streptococcus mutans in the sample may be utilized as an indication of the presence of its colonization.

          We detected the presence of Streptococcus mutans genomic DNA copies in a number of caries-free individuals (Table 1). This result may be interpreted in a number of ways. Streptococcus mutans in the saliva is necessary but not sufficient to determine the disease and/or the presence of carious lesions. The microorganism may be present in caries free individuals, but their detectable levels are lower. Another possibility is that up to 10% of caries lesions may be missed by the use of the methodology recommended by the World Health Organization without complementation of radiographs [9].

          Slayton et al. [10] showed that Streptococcus mutans levels were positively associated with caries experience in children 3 to 5 years of age. The authors measured levels of Streptococcus mutans by microbiological assays, according to the protocol described by Edelstein and Tinanoff [11], by touching a wooden tongue blade to the dorsal surface of the tongue until wet and then using the tongue blade to inoculate selective growth medium for Streptococcus mutans (CRT Bacteria Kit, IvoclarVivadent, Schaan, Liechtenstein). Also, a significant interaction was suggested between genetic variation in tuftelin, a gene suggested to be involved in enamel formation, and levels of Streptococcus mutans. Previously we were not able to replicate the results of a possible interaction between variation in tuftelin and levels of Streptococcus mutans [12]. We used the same real-time PCR assay described here to define presence or absence of Streptococcus mutans colonization in the study. However, our current analysis confirms Streptococcus mutans levels are associated with caries experience in children, corroborating the findings by Slayton et al. [10]. Our results clearly show that DMFT scores of adults do not correlate with Streptococcus mutans colonization measured by real-time PCR assays. The likely reason is that Streptococcus mutans are associated with the initiation of the disease, which usually affects children, and caries experience scores (dmft) are mostly related to the presence of decayed teeth. In adults, DMFT scores are also influenced by the number of teeth missing and filled due to caries and although the DMFT score tends to increase overtime in all individuals, levels of Streptococcus mutans will be elevated the most in instances where new carious lesions in enamel are developing. Streptococcus mutans counts also correlate with sugar intake and one can argue that individual variation in diet modifies expected bacteria counts, although this hypothesis cannot be easily tested in a cross-sectional study design. These clearly shows the need for a deep understanding of the etiopathogenesis of caries when proposing to study genetic susceptibility to the disease. Our study confirms that in children, levels of Streptococcus mutans clearly correlate with higher caries experience and higher susceptibility to the disease.

          There is increasing interest in understanding the potential influence of oral health on systemic health. It has been suggested that higher caries rates can be found in individuals with specific systemic diseases such as cardiovascular diseases [13], asthma, and epilepsy [14]. We were not able to detect any levels of Streptococcus mutans in the DNA samples extracted from peripheral blood. This may be due to the method used for DNA extraction, which may poorly recover Streptococcus mutans genomic DNA in the sample or because of the low level of Streptococcus mutans in the original specimen. Evidence exists that Streptococcus mutans can be detected in heart valve and atheromatous plaque samples [6, 7] and therefore travel from the mouth to the heart. The explanation is likely that very small numbers of bacteria copies, below the sensitivity of the real-time PCR assay, can be found in any given volume of blood of someone affected. While the concentration of Streptococcus mutans varies based on the nature of the sample collected (blood or saliva) and on how it is collected (whole saliva or buffered saliva), DNA isolation methods do not appear to importantly influence the recovery of genomic DNA of Streptococcus mutans or the performance of this PCR-based assay [5]. There is great interest in approaches that can help predict how oral health can affect systemic health and future work in our laboratory will aim to identify variables that can serve as predictors of poor systemic health.

          Our data provides a rationale for focusing future genetic studies of caries in younger populations, in which levels of Streptococcus mutans better correlate with existing measures of disease experience, and sampling tends to be more homogeneous.

          Acknowledgments

          None of the authors have a direct financial relation with any commercial identities mentioned in this paper, nor have any other conflict of interests to declare. The authors are indebted to all the subjects who enthusiastically agreed to be part of this project. Melissa Carp revised the text for grammar and style. Data for this study were provided by the Dental Registry and DNA Repository of the School of Dental Medicine, University of Pittsburgh. They thank Children of the Americas, Inc., for their support during data collection in Guatemala. N. F. Callahan and I. Anjomshoaa were supported by the CTSI START UP program, the short-term pre-doctoral award through the Clinical and Translational Science Institute and the Institute for Clinical Research Education at the University of Pittsburgh (NIH Grant 5TL1RR024155-02). Financial support for this work was provided by NIH Grants R01-DE018914 (to A. R. Vieira), R01-DE014899 (to M. L. Marazita, A. R. Vieira, R. J. Weyant, R. Crout, D. W. McNeil), R01-DE016148 (M. L. Marazita, A. R. Vieira, E. E. Castilla), P50-DE016215 (to M. L. Marazita) by the Agencia Nacional de Promoción Científica y Tecnológica (ANPCyT), Argentina, Grant no.: PICTO-CRUP 2005 no. 31101 by the Consejo Nacional de Investigaciones Científicas y Técnicas (CONICET), Argentina for ECLAMC financial support from CNPq (National Research council of Brazil), process # 573993/2008-4 INAGEMP. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the paper.

          References

          1. World Health Organization, “The world oral health report 2003,” Tech. Rep., World Health Organization, Geneva, Switzerland, 2003. View at: Google Scholar
          2. T. Rylander-Rudqvist, N. Håkansson, G. Tybring, and A. Wolk, “Quality and quantity of saliva DNA obtained from the self-administrated oragene method—a pilot study on the cohort of Swedish men,” Cancer Epidemiology Biomarkers and Prevention, vol. 15, no. 9, pp. 1742–1745, 2006. View at: Publisher Site | Google Scholar
          3. J. M. Tanzer, J. Livingston, and A. M. Thompson, “The microbiology of primary dental caries in humans,” Journal of Dental Education, vol. 65, no. 10, pp. 1028–1037, 2001. View at: Google Scholar
          4. O. G. Gold, H. V. Jordan, and J. Van Houte, “A selective medium for Streptococcus mutans,” Archives of Oral Biology, vol. 18, no. 11, pp. 1357–1364, 1973. View at: Google Scholar
          5. A. Yano, N. Kaneko, H. Ida, T. Yamaguchi, and N. Hanada, “Real-time PCR for quantification of Streptococcus mutans,” FEMS Microbiology Letters, vol. 217, no. 1, pp. 23–30, 2002. View at: Publisher Site | Google Scholar
          6. K. Nakano, H. Inaba, R. Nomura et al., “Detection of cariogenic Streptococcus mutans in extirpated heart valve and atheromatous plaque specimens,” Journal of Clinical Microbiology, vol. 44, no. 9, pp. 3313–3317, 2006. View at: Publisher Site | Google Scholar
          7. K. Nakano, H. Nemoto, R. Nomura et al., “Detection of oral bacteria in cardiovascular specimens,” Oral Microbiology and Immunology, vol. 24, no. 1, pp. 64–68, 2009. View at: Publisher Site | Google Scholar
          8. R. M. Iwasiow, A. Desbois, and H. C. Birnboim, Long-Term Stability of DNA from Saliva Samples Stored in Oragene®DNA, DNA Genotek, Ontario, Canada, 2004.
          9. S. F. Mestriner, L. C. Pardini, and W. Mestriner, “Impact of the bitewing radiography exam inclusion on the prevalence of dental caries in 12-year-old students in the city of Franca, São Paulo, Brazil,” Journal of Applied Oral Science, vol. 14, no. 3, pp. 167–171, 2006. View at: Google Scholar
          10. R. L. Slayton, M. E. Cooper, and M. L. Marazita, “Tuftelin, mutans streptococci, and dental caries susceptibility,” Journal of Dental Research, vol. 84, no. 8, pp. 711–714, 2005. View at: Publisher Site | Google Scholar
          11. B. Edelstein and N. Tinanoff, “Screening preschool children for dental caries using a microbial test,” Pediatric dentistry, vol. 11, no. 2, pp. 129–132, 1989. View at: Google Scholar
          12. K. Deeley, A. Letra, E. K. Rose et al., “Possible association of amelogenin to high caries experience in a guatemalan-mayan population,” Caries Research, vol. 42, no. 1, pp. 8–13, 2008. View at: Publisher Site | Google Scholar
          13. P. Holm-Pedersen, K. Avlund, D. E. Morse et al., “Dental caries, periodontal disease, and cardiac arrhythmias in community-dwelling older persons aged 80 and older: is there a link?” Journal of the American Geriatrics Society, vol. 53, no. 3, pp. 430–437, 2005. View at: Publisher Site | Google Scholar
          14. I. Anjomshoaa, M. E. Cooper, and A. R. Vieira, “Caries is associated with asthma and epilepsy,” European Journal of Dental, vol. 3, pp. 297–303, 2009. View at: Google Scholar

          Copyright

          Copyright © 2011 Alexandre R. Vieira et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.



Comments:

  1. Aethelstun

    You are not right. I can defend my position. Write to me in PM, we will discuss.

  2. Mezigar

    I regret, but I can help nothing. I know, you will find the correct decision. Do not despair.

  3. Oran

    it is possible to argue so infinitely.

  4. Tredan

    Hello, I went to your project from Yandex and Kaspersky began to swear at viruses = (

  5. Juzshura

    Authoritative answer, informative ...



Write a message